Incidental Mutation 'R4865:Tmem67'
ID374812
Institutional Source Beutler Lab
Gene Symbol Tmem67
Ensembl Gene ENSMUSG00000049488
Gene Nametransmembrane protein 67
Synonymsb2b1291.1Clo, 5330408M12Rik, b2b1163.1Clo
MMRRC Submission 042475-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4865 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location12039355-12090020 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 12070262 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 387 (N387S)
Ref Sequence ENSEMBL: ENSMUSP00000103928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050686] [ENSMUST00000108293]
Predicted Effect probably benign
Transcript: ENSMUST00000050686
AA Change: N321S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000052644
Gene: ENSMUSG00000049488
AA Change: N321S

DomainStartEndE-ValueType
low complexity region 17 23 N/A INTRINSIC
Pfam:Meckelin 166 995 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108293
AA Change: N387S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000103928
Gene: ENSMUSG00000049488
AA Change: N387S

DomainStartEndE-ValueType
low complexity region 83 89 N/A INTRINSIC
Pfam:Meckelin 236 1061 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131145
SMART Domains Protein: ENSMUSP00000115154
Gene: ENSMUSG00000049488

DomainStartEndE-ValueType
low complexity region 15 21 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146140
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147746
Meta Mutation Damage Score 0.1056 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 98% (86/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene localizes to the primary cilium and to the plasma membrane. The gene functions in centriole migration to the apical membrane and formation of the primary cilium. Multiple transcript variants encoding different isoforms have been found for this gene. Defects in this gene are a cause of Meckel syndrome type 3 (MKS3) and Joubert syndrome type 6 (JBTS6). [provided by RefSeq, Nov 2008]
PHENOTYPE: Mice homozygous for a targeted allele exhibit neonatal/postanal lethality, kidney cysts, and Meckel-Gruber or Joubert syndrome-like phenotypes depending on the filial generation of the backcross to C57BL/6J. Mice homozygous for an ENU-induced allele exhibit cardiovascular defects and cystic kidney. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim3 C T 18: 61,805,086 V639M probably damaging Het
Adgrf4 A G 17: 42,667,265 S396P probably damaging Het
Aldh3b2 T A 19: 3,978,469 I123N probably damaging Het
Aldh5a1 A G 13: 24,911,584 Y517H probably damaging Het
Aph1c A C 9: 66,827,838 I77S probably damaging Het
Armc8 A G 9: 99,526,889 probably null Het
Atp13a5 G A 16: 29,248,160 P1020L probably damaging Het
BC024139 A T 15: 76,126,066 M80K possibly damaging Het
Cdk5rap1 C T 2: 154,370,956 probably null Het
Cenpn A G 8: 116,934,773 I204V probably damaging Het
Ces4a A T 8: 105,147,158 M420L probably benign Het
Chdh T A 14: 30,033,724 D322E probably benign Het
Clcn6 A T 4: 148,019,766 I223N probably damaging Het
Clec4b1 A G 6: 123,068,469 K50E possibly damaging Het
Creg1 T A 1: 165,769,863 C135* probably null Het
Cyp4f13 C T 17: 32,925,704 R411Q probably damaging Het
Dnah7b T C 1: 46,195,074 F1426L probably damaging Het
Dock9 A T 14: 121,543,505 *1917R probably null Het
Dync1h1 T G 12: 110,639,801 L2435R possibly damaging Het
Eif3l C A 15: 79,081,649 Y166* probably null Het
Emilin1 T A 5: 30,917,784 N456K possibly damaging Het
Fam83f C T 15: 80,692,449 R434C probably damaging Het
Fbxw9 A G 8: 85,060,156 D10G possibly damaging Het
Flt1 C A 5: 147,683,939 A132S probably benign Het
Fsip2 T G 2: 82,990,951 V5676G possibly damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gm11596 A G 11: 99,793,238 probably benign Het
Gm6522 T C 3: 106,275,970 noncoding transcript Het
Gm6728 A G 6: 136,487,074 noncoding transcript Het
Gria4 T A 9: 4,464,295 I556F possibly damaging Het
Grp A T 18: 65,879,970 D69V probably damaging Het
Gucy1a1 G T 3: 82,119,162 probably benign Het
Haus5 A T 7: 30,658,555 L376Q probably damaging Het
Ifne A T 4: 88,879,705 Y159N probably damaging Het
Ift80 A G 3: 68,990,759 V81A probably benign Het
Inpp5b T C 4: 124,751,495 V192A probably benign Het
Kcnh4 A G 11: 100,749,743 S486P probably damaging Het
Kif5b A G 18: 6,222,912 probably benign Het
Macf1 T A 4: 123,433,303 E4800D probably damaging Het
Mblac2 C T 13: 81,711,976 Q150* probably null Het
Mc1r A T 8: 123,407,516 T3S probably benign Het
Med17 G A 9: 15,265,372 Q70* probably null Het
Myocd A T 11: 65,179,030 probably null Het
Nphp3 T C 9: 104,031,970 L793P probably benign Het
Olfr1020 T A 2: 85,849,716 M88K probably damaging Het
Olfr1240 T G 2: 89,439,659 T207P possibly damaging Het
Olfr1377 A G 11: 50,985,543 T281A probably damaging Het
Olfr1436 T C 19: 12,298,580 D184G probably damaging Het
Olfr165 A T 16: 19,407,301 F238L probably damaging Het
Olfr891 T A 9: 38,179,900 T308S possibly damaging Het
Piezo1 A T 8: 122,486,921 L1745Q probably damaging Het
Prdm10 T A 9: 31,347,080 H600Q probably damaging Het
Psapl1 C A 5: 36,204,867 L268M probably damaging Het
Psg23 T C 7: 18,612,114 I219V probably benign Het
Rexo5 A T 7: 119,801,330 R113* probably null Het
Rgs22 A T 15: 36,100,212 I243N probably damaging Het
Rhbdf1 G A 11: 32,214,517 T183I probably damaging Het
Rhobtb1 T C 10: 69,270,724 M373T probably benign Het
Ros1 G T 10: 52,172,870 A88E probably damaging Het
Sdr16c6 A G 4: 4,058,834 F251L probably benign Het
Skil A G 3: 31,113,413 Y398C probably damaging Het
Slc22a3 A T 17: 12,464,532 M148K probably benign Het
Slco4c1 G A 1: 96,841,228 P303L probably damaging Het
Sntn A T 14: 13,679,103 K92N probably benign Het
Spry4 A T 18: 38,589,823 S296T probably benign Het
St8sia1 A G 6: 142,829,070 F261S probably damaging Het
Stab2 C T 10: 86,843,500 probably null Het
Stk24 A T 14: 121,293,454 C363* probably null Het
Tank G A 2: 61,578,635 probably benign Het
Treml1 A T 17: 48,366,857 I304L probably benign Het
Trim13 A G 14: 61,605,517 I328V probably benign Het
Upk2 A G 9: 44,454,085 V62A probably damaging Het
Urb2 A T 8: 124,029,635 K694* probably null Het
Vmn2r17 C A 5: 109,427,119 N97K probably damaging Het
Vmn2r57 A T 7: 41,400,468 V619D probably damaging Het
Vmn2r92 G A 17: 18,167,372 R213Q probably benign Het
Wnt6 G A 1: 74,782,629 C123Y probably damaging Het
Zfp292 A G 4: 34,819,563 I253T probably damaging Het
Zfp52 C T 17: 21,561,243 S451L probably damaging Het
Other mutations in Tmem67
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Tmem67 APN 4 12061826 missense probably damaging 0.98
IGL00768:Tmem67 APN 4 12055029 critical splice donor site probably null
IGL00813:Tmem67 APN 4 12058587 splice site probably benign
IGL01070:Tmem67 APN 4 12054750 missense probably benign 0.20
IGL01088:Tmem67 APN 4 12063126 missense probably damaging 1.00
IGL01353:Tmem67 APN 4 12079895 missense probably damaging 1.00
IGL01490:Tmem67 APN 4 12057422 splice site probably benign
IGL01885:Tmem67 APN 4 12057389 missense probably damaging 1.00
IGL02061:Tmem67 APN 4 12053526 missense probably damaging 1.00
IGL02151:Tmem67 APN 4 12068882 missense probably benign 0.35
IGL02166:Tmem67 APN 4 12047313 missense possibly damaging 0.90
IGL02243:Tmem67 APN 4 12070584 missense possibly damaging 0.93
IGL02517:Tmem67 APN 4 12069463 missense possibly damaging 0.67
IGL02736:Tmem67 APN 4 12045789 splice site probably null
R0282:Tmem67 UTSW 4 12087930 missense probably damaging 0.99
R0514:Tmem67 UTSW 4 12089317 missense probably benign
R1221:Tmem67 UTSW 4 12045871 missense possibly damaging 0.92
R1301:Tmem67 UTSW 4 12089400 unclassified probably benign
R1581:Tmem67 UTSW 4 12047814 missense probably damaging 1.00
R1680:Tmem67 UTSW 4 12087840 missense probably benign 0.00
R1804:Tmem67 UTSW 4 12045789 splice site probably null
R2174:Tmem67 UTSW 4 12063730 nonsense probably null
R2191:Tmem67 UTSW 4 12069413 critical splice donor site probably null
R2246:Tmem67 UTSW 4 12040651 missense probably damaging 1.00
R2566:Tmem67 UTSW 4 12079918 missense probably damaging 0.99
R3409:Tmem67 UTSW 4 12073952 missense probably benign 0.00
R3410:Tmem67 UTSW 4 12073952 missense probably benign 0.00
R4078:Tmem67 UTSW 4 12040633 critical splice donor site probably null
R4282:Tmem67 UTSW 4 12073922 missense probably damaging 0.99
R4429:Tmem67 UTSW 4 12051473 missense possibly damaging 0.52
R4430:Tmem67 UTSW 4 12051473 missense possibly damaging 0.52
R4431:Tmem67 UTSW 4 12051473 missense possibly damaging 0.52
R4734:Tmem67 UTSW 4 12063158 missense probably benign 0.00
R4856:Tmem67 UTSW 4 12089416 unclassified probably benign
R5056:Tmem67 UTSW 4 12070471 missense probably benign 0.29
R5575:Tmem67 UTSW 4 12047886 missense possibly damaging 0.93
R5614:Tmem67 UTSW 4 12061755 missense possibly damaging 0.54
R6030:Tmem67 UTSW 4 12063799 missense probably benign 0.01
R6030:Tmem67 UTSW 4 12063799 missense probably benign 0.01
R6182:Tmem67 UTSW 4 12051402 missense probably benign 0.05
R6562:Tmem67 UTSW 4 12053445 critical splice donor site probably null
R6574:Tmem67 UTSW 4 12063086 missense possibly damaging 0.70
R6696:Tmem67 UTSW 4 12061754 critical splice donor site probably null
R6824:Tmem67 UTSW 4 12051449 missense probably damaging 1.00
R7028:Tmem67 UTSW 4 12075484 missense probably benign 0.12
R7174:Tmem67 UTSW 4 12077337 missense possibly damaging 0.82
R7369:Tmem67 UTSW 4 12053535 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTGTGACTAGTGACTGTGTC -3'
(R):5'- CCATTCTGGTGAGGAAATTTGGATG -3'

Sequencing Primer
(F):5'- ccatctccagGCATAGTT -3'
(R):5'- TGGATGTGTTAAATACTCCAGTGG -3'
Posted On2016-03-17