Incidental Mutation 'R4865:Zfp292'
ID374813
Institutional Source Beutler Lab
Gene Symbol Zfp292
Ensembl Gene ENSMUSG00000039967
Gene Namezinc finger protein 292
SynonymsZn-16, 5730450D02Rik, Zfp15, Zn-15, Zfp-15, 9430062L07Rik, Krox-10
MMRRC Submission 042475-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.711) question?
Stock #R4865 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location34803113-34882960 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34819563 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 253 (I253T)
Ref Sequence ENSEMBL: ENSMUSP00000095766 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047950] [ENSMUST00000098163]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047950
AA Change: I258T

PolyPhen 2 Score 0.871 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000037233
Gene: ENSMUSG00000039967
AA Change: I258T

DomainStartEndE-ValueType
low complexity region 19 39 N/A INTRINSIC
low complexity region 101 120 N/A INTRINSIC
low complexity region 512 523 N/A INTRINSIC
ZnF_C2H2 540 561 5.12e1 SMART
ZnF_C2H2 567 589 4.72e-2 SMART
low complexity region 649 664 N/A INTRINSIC
ZnF_C2H2 681 705 3.52e-1 SMART
ZnF_C2H2 722 744 1.53e-1 SMART
ZnF_C2H2 750 774 1.62e0 SMART
ZnF_C2H2 779 803 1.08e1 SMART
ZnF_C2H2 807 831 1.95e-3 SMART
low complexity region 1062 1078 N/A INTRINSIC
ZnF_C2H2 1085 1110 7.67e-2 SMART
ZnF_C2H2 1361 1381 1.93e2 SMART
low complexity region 1606 1618 N/A INTRINSIC
ZnF_C2H2 1879 1904 4.4e-2 SMART
ZnF_C2H2 1924 1949 5.42e-2 SMART
low complexity region 2004 2014 N/A INTRINSIC
low complexity region 2024 2037 N/A INTRINSIC
coiled coil region 2050 2072 N/A INTRINSIC
ZnF_C2H2 2091 2116 4.45e0 SMART
low complexity region 2121 2143 N/A INTRINSIC
ZnF_C2H2 2149 2174 1.64e-1 SMART
ZnF_C2H2 2193 2218 3.24e0 SMART
ZnF_C2H2 2233 2258 1.18e-2 SMART
low complexity region 2301 2314 N/A INTRINSIC
ZnF_C2H2 2362 2386 2.86e-1 SMART
low complexity region 2589 2605 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098163
AA Change: I253T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095766
Gene: ENSMUSG00000039967
AA Change: I253T

DomainStartEndE-ValueType
low complexity region 19 39 N/A INTRINSIC
low complexity region 101 120 N/A INTRINSIC
low complexity region 507 518 N/A INTRINSIC
ZnF_C2H2 535 556 5.12e1 SMART
ZnF_C2H2 562 584 4.72e-2 SMART
low complexity region 644 659 N/A INTRINSIC
ZnF_C2H2 676 700 3.52e-1 SMART
ZnF_C2H2 717 739 1.53e-1 SMART
ZnF_C2H2 745 769 1.62e0 SMART
ZnF_C2H2 774 798 1.08e1 SMART
ZnF_C2H2 802 826 1.95e-3 SMART
low complexity region 1057 1073 N/A INTRINSIC
ZnF_C2H2 1080 1105 7.67e-2 SMART
ZnF_C2H2 1356 1376 1.93e2 SMART
low complexity region 1601 1613 N/A INTRINSIC
ZnF_C2H2 1874 1899 4.4e-2 SMART
ZnF_C2H2 1919 1944 5.42e-2 SMART
low complexity region 1999 2009 N/A INTRINSIC
low complexity region 2019 2032 N/A INTRINSIC
coiled coil region 2045 2067 N/A INTRINSIC
ZnF_C2H2 2086 2111 4.45e0 SMART
low complexity region 2116 2138 N/A INTRINSIC
ZnF_C2H2 2144 2169 1.64e-1 SMART
ZnF_C2H2 2188 2213 3.24e0 SMART
ZnF_C2H2 2228 2253 1.18e-2 SMART
low complexity region 2296 2309 N/A INTRINSIC
ZnF_C2H2 2357 2381 2.86e-1 SMART
low complexity region 2584 2600 N/A INTRINSIC
Meta Mutation Damage Score 0.28 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 98% (86/88)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim3 C T 18: 61,805,086 V639M probably damaging Het
Adgrf4 A G 17: 42,667,265 S396P probably damaging Het
Aldh3b2 T A 19: 3,978,469 I123N probably damaging Het
Aldh5a1 A G 13: 24,911,584 Y517H probably damaging Het
Aph1c A C 9: 66,827,838 I77S probably damaging Het
Armc8 A G 9: 99,526,889 probably null Het
Atp13a5 G A 16: 29,248,160 P1020L probably damaging Het
BC024139 A T 15: 76,126,066 M80K possibly damaging Het
Cdk5rap1 C T 2: 154,370,956 probably null Het
Cenpn A G 8: 116,934,773 I204V probably damaging Het
Ces4a A T 8: 105,147,158 M420L probably benign Het
Chdh T A 14: 30,033,724 D322E probably benign Het
Clcn6 A T 4: 148,019,766 I223N probably damaging Het
Clec4b1 A G 6: 123,068,469 K50E possibly damaging Het
Creg1 T A 1: 165,769,863 C135* probably null Het
Cyp4f13 C T 17: 32,925,704 R411Q probably damaging Het
Dnah7b T C 1: 46,195,074 F1426L probably damaging Het
Dock9 A T 14: 121,543,505 *1917R probably null Het
Dync1h1 T G 12: 110,639,801 L2435R possibly damaging Het
Eif3l C A 15: 79,081,649 Y166* probably null Het
Emilin1 T A 5: 30,917,784 N456K possibly damaging Het
Fam83f C T 15: 80,692,449 R434C probably damaging Het
Fbxw9 A G 8: 85,060,156 D10G possibly damaging Het
Flt1 C A 5: 147,683,939 A132S probably benign Het
Fsip2 T G 2: 82,990,951 V5676G possibly damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gm11596 A G 11: 99,793,238 probably benign Het
Gm6522 T C 3: 106,275,970 noncoding transcript Het
Gm6728 A G 6: 136,487,074 noncoding transcript Het
Gria4 T A 9: 4,464,295 I556F possibly damaging Het
Grp A T 18: 65,879,970 D69V probably damaging Het
Gucy1a1 G T 3: 82,119,162 probably benign Het
Haus5 A T 7: 30,658,555 L376Q probably damaging Het
Ifne A T 4: 88,879,705 Y159N probably damaging Het
Ift80 A G 3: 68,990,759 V81A probably benign Het
Inpp5b T C 4: 124,751,495 V192A probably benign Het
Kcnh4 A G 11: 100,749,743 S486P probably damaging Het
Kif5b A G 18: 6,222,912 probably benign Het
Macf1 T A 4: 123,433,303 E4800D probably damaging Het
Mblac2 C T 13: 81,711,976 Q150* probably null Het
Mc1r A T 8: 123,407,516 T3S probably benign Het
Med17 G A 9: 15,265,372 Q70* probably null Het
Myocd A T 11: 65,179,030 probably null Het
Nphp3 T C 9: 104,031,970 L793P probably benign Het
Olfr1020 T A 2: 85,849,716 M88K probably damaging Het
Olfr1240 T G 2: 89,439,659 T207P possibly damaging Het
Olfr1377 A G 11: 50,985,543 T281A probably damaging Het
Olfr1436 T C 19: 12,298,580 D184G probably damaging Het
Olfr165 A T 16: 19,407,301 F238L probably damaging Het
Olfr891 T A 9: 38,179,900 T308S possibly damaging Het
Piezo1 A T 8: 122,486,921 L1745Q probably damaging Het
Prdm10 T A 9: 31,347,080 H600Q probably damaging Het
Psapl1 C A 5: 36,204,867 L268M probably damaging Het
Psg23 T C 7: 18,612,114 I219V probably benign Het
Rexo5 A T 7: 119,801,330 R113* probably null Het
Rgs22 A T 15: 36,100,212 I243N probably damaging Het
Rhbdf1 G A 11: 32,214,517 T183I probably damaging Het
Rhobtb1 T C 10: 69,270,724 M373T probably benign Het
Ros1 G T 10: 52,172,870 A88E probably damaging Het
Sdr16c6 A G 4: 4,058,834 F251L probably benign Het
Skil A G 3: 31,113,413 Y398C probably damaging Het
Slc22a3 A T 17: 12,464,532 M148K probably benign Het
Slco4c1 G A 1: 96,841,228 P303L probably damaging Het
Sntn A T 14: 13,679,103 K92N probably benign Het
Spry4 A T 18: 38,589,823 S296T probably benign Het
St8sia1 A G 6: 142,829,070 F261S probably damaging Het
Stab2 C T 10: 86,843,500 probably null Het
Stk24 A T 14: 121,293,454 C363* probably null Het
Tank G A 2: 61,578,635 probably benign Het
Tmem67 T C 4: 12,070,262 N387S probably benign Het
Treml1 A T 17: 48,366,857 I304L probably benign Het
Trim13 A G 14: 61,605,517 I328V probably benign Het
Upk2 A G 9: 44,454,085 V62A probably damaging Het
Urb2 A T 8: 124,029,635 K694* probably null Het
Vmn2r17 C A 5: 109,427,119 N97K probably damaging Het
Vmn2r57 A T 7: 41,400,468 V619D probably damaging Het
Vmn2r92 G A 17: 18,167,372 R213Q probably benign Het
Wnt6 G A 1: 74,782,629 C123Y probably damaging Het
Zfp52 C T 17: 21,561,243 S451L probably damaging Het
Other mutations in Zfp292
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Zfp292 APN 4 34808683 missense probably benign 0.15
IGL00502:Zfp292 APN 4 34809775 missense possibly damaging 0.63
IGL00539:Zfp292 APN 4 34808790 missense probably damaging 0.98
IGL00676:Zfp292 APN 4 34807827 missense probably damaging 0.99
IGL01068:Zfp292 APN 4 34806763 missense probably damaging 1.00
IGL01311:Zfp292 APN 4 34807961 missense probably benign 0.01
IGL01639:Zfp292 APN 4 34809048 missense probably benign 0.04
IGL01688:Zfp292 APN 4 34807855 missense possibly damaging 0.93
IGL02345:Zfp292 APN 4 34809244 missense possibly damaging 0.94
IGL02444:Zfp292 APN 4 34808810 missense possibly damaging 0.87
IGL02548:Zfp292 APN 4 34805416 missense probably damaging 1.00
IGL02551:Zfp292 APN 4 34806462 missense possibly damaging 0.93
IGL02702:Zfp292 APN 4 34809415 missense probably benign 0.14
IGL02715:Zfp292 APN 4 34819542 missense probably damaging 1.00
IGL03273:Zfp292 APN 4 34806163 missense probably benign 0.00
F5770:Zfp292 UTSW 4 34806783 missense possibly damaging 0.85
PIT4362001:Zfp292 UTSW 4 34807524 missense probably benign 0.00
R0153:Zfp292 UTSW 4 34811185 missense probably benign 0.26
R0184:Zfp292 UTSW 4 34819563 missense probably damaging 1.00
R0295:Zfp292 UTSW 4 34806281 missense probably damaging 1.00
R0367:Zfp292 UTSW 4 34808227 missense probably benign 0.25
R0433:Zfp292 UTSW 4 34839959 missense probably damaging 0.99
R0481:Zfp292 UTSW 4 34810059 missense probably benign 0.28
R0555:Zfp292 UTSW 4 34807194 missense probably damaging 1.00
R0597:Zfp292 UTSW 4 34807399 missense probably benign 0.02
R0748:Zfp292 UTSW 4 34816424 splice site probably benign
R0782:Zfp292 UTSW 4 34839382 missense possibly damaging 0.94
R0834:Zfp292 UTSW 4 34809114 missense probably benign 0.00
R0879:Zfp292 UTSW 4 34811218 missense probably benign 0.00
R1083:Zfp292 UTSW 4 34807569 missense probably damaging 0.98
R1343:Zfp292 UTSW 4 34805238 missense probably damaging 0.98
R1498:Zfp292 UTSW 4 34805397 missense possibly damaging 0.88
R1714:Zfp292 UTSW 4 34808935 missense probably damaging 1.00
R1724:Zfp292 UTSW 4 34811237 missense probably damaging 1.00
R1755:Zfp292 UTSW 4 34811043 missense probably benign 0.02
R1837:Zfp292 UTSW 4 34810264 missense probably damaging 0.98
R1914:Zfp292 UTSW 4 34805100 missense possibly damaging 0.92
R1915:Zfp292 UTSW 4 34805100 missense possibly damaging 0.92
R1936:Zfp292 UTSW 4 34807452 missense probably benign 0.22
R2107:Zfp292 UTSW 4 34808593 missense possibly damaging 0.86
R2108:Zfp292 UTSW 4 34808593 missense possibly damaging 0.86
R2136:Zfp292 UTSW 4 34810266 missense probably benign 0.13
R2182:Zfp292 UTSW 4 34807417 missense probably damaging 1.00
R2186:Zfp292 UTSW 4 34807962 missense probably benign 0.07
R2306:Zfp292 UTSW 4 34809468 missense probably damaging 0.96
R2350:Zfp292 UTSW 4 34811281 missense probably damaging 1.00
R2382:Zfp292 UTSW 4 34806426 missense possibly damaging 0.91
R2872:Zfp292 UTSW 4 34808595 missense probably damaging 1.00
R2872:Zfp292 UTSW 4 34808595 missense probably damaging 1.00
R3018:Zfp292 UTSW 4 34808814 missense probably damaging 0.99
R3812:Zfp292 UTSW 4 34810326 missense probably damaging 0.98
R4006:Zfp292 UTSW 4 34807744 missense probably benign 0.00
R4006:Zfp292 UTSW 4 34809611 missense possibly damaging 0.62
R4060:Zfp292 UTSW 4 34810863 missense probably damaging 1.00
R4062:Zfp292 UTSW 4 34810863 missense probably damaging 1.00
R4063:Zfp292 UTSW 4 34810863 missense probably damaging 1.00
R4064:Zfp292 UTSW 4 34810863 missense probably damaging 1.00
R4207:Zfp292 UTSW 4 34806079 missense probably benign 0.04
R4641:Zfp292 UTSW 4 34807828 missense probably damaging 0.99
R4684:Zfp292 UTSW 4 34807078 missense probably benign 0.00
R4718:Zfp292 UTSW 4 34819521 missense possibly damaging 0.92
R4870:Zfp292 UTSW 4 34808917 missense probably damaging 1.00
R5097:Zfp292 UTSW 4 34839878 missense possibly damaging 0.89
R5233:Zfp292 UTSW 4 34809755 missense probably damaging 1.00
R5246:Zfp292 UTSW 4 34805842 missense possibly damaging 0.76
R5369:Zfp292 UTSW 4 34807491 missense possibly damaging 0.89
R5527:Zfp292 UTSW 4 34806261 missense probably damaging 1.00
R5621:Zfp292 UTSW 4 34811703 missense probably damaging 0.98
R5770:Zfp292 UTSW 4 34806747 missense probably damaging 1.00
R5900:Zfp292 UTSW 4 34805125 missense probably damaging 1.00
R5905:Zfp292 UTSW 4 34819549 missense probably damaging 1.00
R5994:Zfp292 UTSW 4 34805464 missense possibly damaging 0.87
R6028:Zfp292 UTSW 4 34819549 missense probably damaging 1.00
R6056:Zfp292 UTSW 4 34809784 missense probably damaging 1.00
R6093:Zfp292 UTSW 4 34811902 missense probably damaging 1.00
R6126:Zfp292 UTSW 4 34808497 missense probably benign 0.13
R6209:Zfp292 UTSW 4 34809442 missense probably benign 0.14
R6275:Zfp292 UTSW 4 34808883 missense possibly damaging 0.93
R6523:Zfp292 UTSW 4 34816301 missense probably benign 0.21
R6747:Zfp292 UTSW 4 34806894 missense probably damaging 0.97
R6752:Zfp292 UTSW 4 34808593 missense possibly damaging 0.86
R6967:Zfp292 UTSW 4 34807812 missense probably damaging 1.00
R7038:Zfp292 UTSW 4 34816357 missense probably damaging 1.00
R7056:Zfp292 UTSW 4 34809784 missense probably damaging 1.00
R7088:Zfp292 UTSW 4 34806796 missense probably damaging 1.00
R7158:Zfp292 UTSW 4 34808679 missense probably benign
R7254:Zfp292 UTSW 4 34819476 missense probably damaging 0.98
R7350:Zfp292 UTSW 4 34806839 missense probably benign
R7378:Zfp292 UTSW 4 34808384 missense probably benign 0.26
V7580:Zfp292 UTSW 4 34806783 missense possibly damaging 0.85
V7581:Zfp292 UTSW 4 34806783 missense possibly damaging 0.85
V7582:Zfp292 UTSW 4 34806783 missense possibly damaging 0.85
V7583:Zfp292 UTSW 4 34806783 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- GCGTGCACATATCTCCAGAG -3'
(R):5'- ATAACTTGCCAAGTCTTTATCTCAG -3'

Sequencing Primer
(F):5'- ACTGCAGGAGGCCATCTTGATTAC -3'
(R):5'- TTGCCAAGTCTTTATCTCAGTTATC -3'
Posted On2016-03-17