Incidental Mutation 'R4865:Gria4'
ID374839
Institutional Source Beutler Lab
Gene Symbol Gria4
Ensembl Gene ENSMUSG00000025892
Gene Nameglutamate receptor, ionotropic, AMPA4 (alpha 4)
SynonymsGluralpha4, spkw1, Glur4, Glur-4
MMRRC Submission 042475-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.615) question?
Stock #R4865 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location4417896-4796234 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 4464295 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 556 (I556F)
Ref Sequence ENSEMBL: ENSMUSP00000148533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027020] [ENSMUST00000063508] [ENSMUST00000212533]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027020
AA Change: I556F

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000027020
Gene: ENSMUSG00000025892
AA Change: I556F

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 39 380 3e-61 PFAM
PBPe 416 791 8.23e-129 SMART
Lig_chan-Glu_bd 426 491 3.4e-31 SMART
low complexity region 821 833 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000063508
AA Change: I556F

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000066980
Gene: ENSMUSG00000025892
AA Change: I556F

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 39 380 2.5e-71 PFAM
PBPe 416 791 2.06e-129 SMART
Lig_chan-Glu_bd 426 491 3.4e-31 SMART
low complexity region 821 833 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000212533
AA Change: I556F

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
Meta Mutation Damage Score 0.188 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 98% (86/88)
MGI Phenotype FUNCTION: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. These receptors are heteromeric protein complexes composed of multiple subunits, arranged to form ligand-gated ion channels. The classification of glutamate receptors is based on their activation by different pharmacologic agonists. The subunit encoded by this gene belongs to a family of AMPA (alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate)-sensitive glutamate receptors, and is subject to RNA editing (AGA->GGA; R->G). Alternative splicing of this gene results in transcript variants encoding different isoforms, which may vary in their signal transduction properties. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation display hyperactivity, decreased thermal nociception, and abnormal sensitivity to pharmacologically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim3 C T 18: 61,805,086 V639M probably damaging Het
Adgrf4 A G 17: 42,667,265 S396P probably damaging Het
Aldh3b2 T A 19: 3,978,469 I123N probably damaging Het
Aldh5a1 A G 13: 24,911,584 Y517H probably damaging Het
Aph1c A C 9: 66,827,838 I77S probably damaging Het
Armc8 A G 9: 99,526,889 probably null Het
Atp13a5 G A 16: 29,248,160 P1020L probably damaging Het
BC024139 A T 15: 76,126,066 M80K possibly damaging Het
Cdk5rap1 C T 2: 154,370,956 probably null Het
Cenpn A G 8: 116,934,773 I204V probably damaging Het
Ces4a A T 8: 105,147,158 M420L probably benign Het
Chdh T A 14: 30,033,724 D322E probably benign Het
Clcn6 A T 4: 148,019,766 I223N probably damaging Het
Clec4b1 A G 6: 123,068,469 K50E possibly damaging Het
Creg1 T A 1: 165,769,863 C135* probably null Het
Cyp4f13 C T 17: 32,925,704 R411Q probably damaging Het
Dnah7b T C 1: 46,195,074 F1426L probably damaging Het
Dock9 A T 14: 121,543,505 *1917R probably null Het
Dync1h1 T G 12: 110,639,801 L2435R possibly damaging Het
Eif3l C A 15: 79,081,649 Y166* probably null Het
Emilin1 T A 5: 30,917,784 N456K possibly damaging Het
Fam83f C T 15: 80,692,449 R434C probably damaging Het
Fbxw9 A G 8: 85,060,156 D10G possibly damaging Het
Flt1 C A 5: 147,683,939 A132S probably benign Het
Fsip2 T G 2: 82,990,951 V5676G possibly damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gm11596 A G 11: 99,793,238 probably benign Het
Gm6522 T C 3: 106,275,970 noncoding transcript Het
Gm6728 A G 6: 136,487,074 noncoding transcript Het
Grp A T 18: 65,879,970 D69V probably damaging Het
Gucy1a1 G T 3: 82,119,162 probably benign Het
Haus5 A T 7: 30,658,555 L376Q probably damaging Het
Ifne A T 4: 88,879,705 Y159N probably damaging Het
Ift80 A G 3: 68,990,759 V81A probably benign Het
Inpp5b T C 4: 124,751,495 V192A probably benign Het
Kcnh4 A G 11: 100,749,743 S486P probably damaging Het
Kif5b A G 18: 6,222,912 probably benign Het
Macf1 T A 4: 123,433,303 E4800D probably damaging Het
Mblac2 C T 13: 81,711,976 Q150* probably null Het
Mc1r A T 8: 123,407,516 T3S probably benign Het
Med17 G A 9: 15,265,372 Q70* probably null Het
Myocd A T 11: 65,179,030 probably null Het
Nphp3 T C 9: 104,031,970 L793P probably benign Het
Olfr1020 T A 2: 85,849,716 M88K probably damaging Het
Olfr1240 T G 2: 89,439,659 T207P possibly damaging Het
Olfr1377 A G 11: 50,985,543 T281A probably damaging Het
Olfr1436 T C 19: 12,298,580 D184G probably damaging Het
Olfr165 A T 16: 19,407,301 F238L probably damaging Het
Olfr891 T A 9: 38,179,900 T308S possibly damaging Het
Piezo1 A T 8: 122,486,921 L1745Q probably damaging Het
Prdm10 T A 9: 31,347,080 H600Q probably damaging Het
Psapl1 C A 5: 36,204,867 L268M probably damaging Het
Psg23 T C 7: 18,612,114 I219V probably benign Het
Rexo5 A T 7: 119,801,330 R113* probably null Het
Rgs22 A T 15: 36,100,212 I243N probably damaging Het
Rhbdf1 G A 11: 32,214,517 T183I probably damaging Het
Rhobtb1 T C 10: 69,270,724 M373T probably benign Het
Ros1 G T 10: 52,172,870 A88E probably damaging Het
Sdr16c6 A G 4: 4,058,834 F251L probably benign Het
Skil A G 3: 31,113,413 Y398C probably damaging Het
Slc22a3 A T 17: 12,464,532 M148K probably benign Het
Slco4c1 G A 1: 96,841,228 P303L probably damaging Het
Sntn A T 14: 13,679,103 K92N probably benign Het
Spry4 A T 18: 38,589,823 S296T probably benign Het
St8sia1 A G 6: 142,829,070 F261S probably damaging Het
Stab2 C T 10: 86,843,500 probably null Het
Stk24 A T 14: 121,293,454 C363* probably null Het
Tank G A 2: 61,578,635 probably benign Het
Tmem67 T C 4: 12,070,262 N387S probably benign Het
Treml1 A T 17: 48,366,857 I304L probably benign Het
Trim13 A G 14: 61,605,517 I328V probably benign Het
Upk2 A G 9: 44,454,085 V62A probably damaging Het
Urb2 A T 8: 124,029,635 K694* probably null Het
Vmn2r17 C A 5: 109,427,119 N97K probably damaging Het
Vmn2r57 A T 7: 41,400,468 V619D probably damaging Het
Vmn2r92 G A 17: 18,167,372 R213Q probably benign Het
Wnt6 G A 1: 74,782,629 C123Y probably damaging Het
Zfp292 A G 4: 34,819,563 I253T probably damaging Het
Zfp52 C T 17: 21,561,243 S451L probably damaging Het
Other mutations in Gria4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00814:Gria4 APN 9 4472202 missense probably damaging 0.98
IGL01451:Gria4 APN 9 4503652 missense probably benign 0.04
IGL01533:Gria4 APN 9 4502395 missense probably damaging 1.00
IGL01994:Gria4 APN 9 4537726 missense probably damaging 1.00
IGL02078:Gria4 APN 9 4793878 missense probably damaging 0.98
IGL02183:Gria4 APN 9 4502460 missense probably damaging 1.00
IGL02351:Gria4 APN 9 4456206 missense possibly damaging 0.84
IGL02358:Gria4 APN 9 4456206 missense possibly damaging 0.84
IGL03118:Gria4 APN 9 4793804 splice site probably benign
IGL03131:Gria4 APN 9 4432876 missense probably damaging 0.96
IGL03148:Gria4 APN 9 4464295 missense possibly damaging 0.91
IGL03264:Gria4 APN 9 4513288 missense probably benign
PIT4812001:Gria4 UTSW 9 4427128 missense probably damaging 1.00
R0018:Gria4 UTSW 9 4432843 missense possibly damaging 0.71
R0295:Gria4 UTSW 9 4793840 missense possibly damaging 0.69
R0654:Gria4 UTSW 9 4464372 missense probably benign 0.32
R0690:Gria4 UTSW 9 4427071 missense probably damaging 1.00
R0992:Gria4 UTSW 9 4795238 missense probably benign
R1517:Gria4 UTSW 9 4793865 missense probably damaging 1.00
R1673:Gria4 UTSW 9 4537637 nonsense probably null
R1713:Gria4 UTSW 9 4424448 missense probably benign 0.20
R1961:Gria4 UTSW 9 4519546 splice site probably benign
R2137:Gria4 UTSW 9 4427026 intron probably benign
R2397:Gria4 UTSW 9 4537717 missense probably damaging 1.00
R2870:Gria4 UTSW 9 4503614 missense probably damaging 0.96
R2870:Gria4 UTSW 9 4503614 missense probably damaging 0.96
R3014:Gria4 UTSW 9 4464294 missense probably damaging 0.97
R3412:Gria4 UTSW 9 4513278 missense probably benign 0.00
R3732:Gria4 UTSW 9 4513295 missense probably benign
R3732:Gria4 UTSW 9 4513295 missense probably benign
R3733:Gria4 UTSW 9 4513295 missense probably benign
R3897:Gria4 UTSW 9 4513260 missense probably damaging 1.00
R4404:Gria4 UTSW 9 4464489 splice site probably null
R4457:Gria4 UTSW 9 4427074 missense probably damaging 1.00
R4672:Gria4 UTSW 9 4664981 missense possibly damaging 0.96
R5092:Gria4 UTSW 9 4472176 missense probably benign 0.01
R5109:Gria4 UTSW 9 4472168 missense probably damaging 1.00
R5202:Gria4 UTSW 9 4424330 missense probably benign 0.10
R5828:Gria4 UTSW 9 4432832 missense probably damaging 1.00
R5945:Gria4 UTSW 9 4456122 missense probably damaging 1.00
R5985:Gria4 UTSW 9 4503593 missense probably damaging 0.99
R6036:Gria4 UTSW 9 4537646 missense probably benign 0.00
R6036:Gria4 UTSW 9 4537646 missense probably benign 0.00
R6111:Gria4 UTSW 9 4502430 missense probably damaging 1.00
R6190:Gria4 UTSW 9 4420199 missense probably benign
R6280:Gria4 UTSW 9 4456072 missense probably damaging 1.00
R6406:Gria4 UTSW 9 4427077 missense probably damaging 1.00
R6470:Gria4 UTSW 9 4503680 missense probably damaging 1.00
R6485:Gria4 UTSW 9 4464249 missense probably damaging 1.00
R6612:Gria4 UTSW 9 4472206 missense possibly damaging 0.93
R6848:Gria4 UTSW 9 4793822 missense probably damaging 1.00
R7046:Gria4 UTSW 9 4420278 missense probably damaging 0.97
R7210:Gria4 UTSW 9 4464135 missense probably damaging 1.00
R7284:Gria4 UTSW 9 4472017 missense probably damaging 1.00
R7475:Gria4 UTSW 9 4513330 missense probably damaging 1.00
R7501:Gria4 UTSW 9 4502436 missense probably benign 0.01
R7536:Gria4 UTSW 9 4464298 missense probably damaging 1.00
X0023:Gria4 UTSW 9 4427067 missense probably damaging 1.00
X0065:Gria4 UTSW 9 4464340 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- ATGTCACATCCTTGTTGCATAAAGG -3'
(R):5'- CACTAACTTGTGTATTCCCACGTG -3'

Sequencing Primer
(F):5'- CTTGTTGCATAAAGGCACCCAGG -3'
(R):5'- TTCTCTTGTAGAAAGCAGAGATTGCC -3'
Posted On2016-03-17