Incidental Mutation 'R4865:Myocd'
ID374852
Institutional Source Beutler Lab
Gene Symbol Myocd
Ensembl Gene ENSMUSG00000020542
Gene Namemyocardin
SynonymsSrfcp
MMRRC Submission 042475-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4865 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location65176561-65269989 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 65179030 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000104335 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101042] [ENSMUST00000101042] [ENSMUST00000101042] [ENSMUST00000101042] [ENSMUST00000101042] [ENSMUST00000101042] [ENSMUST00000102635] [ENSMUST00000102635] [ENSMUST00000102635] [ENSMUST00000108695] [ENSMUST00000108695] [ENSMUST00000108695]
Predicted Effect probably null
Transcript: ENSMUST00000101042
SMART Domains Protein: ENSMUSP00000098603
Gene: ENSMUSG00000020542

DomainStartEndE-ValueType
low complexity region 19 32 N/A INTRINSIC
low complexity region 119 132 N/A INTRINSIC
SCOP:d1lsha3 140 221 4e-3 SMART
SAP 252 286 1.29e-8 SMART
low complexity region 326 343 N/A INTRINSIC
low complexity region 371 383 N/A INTRINSIC
coiled coil region 396 435 N/A INTRINSIC
low complexity region 557 573 N/A INTRINSIC
low complexity region 615 629 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000101042
SMART Domains Protein: ENSMUSP00000098603
Gene: ENSMUSG00000020542

DomainStartEndE-ValueType
low complexity region 19 32 N/A INTRINSIC
low complexity region 119 132 N/A INTRINSIC
SCOP:d1lsha3 140 221 4e-3 SMART
SAP 252 286 1.29e-8 SMART
low complexity region 326 343 N/A INTRINSIC
low complexity region 371 383 N/A INTRINSIC
coiled coil region 396 435 N/A INTRINSIC
low complexity region 557 573 N/A INTRINSIC
low complexity region 615 629 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000101042
SMART Domains Protein: ENSMUSP00000098603
Gene: ENSMUSG00000020542

DomainStartEndE-ValueType
low complexity region 19 32 N/A INTRINSIC
low complexity region 119 132 N/A INTRINSIC
SCOP:d1lsha3 140 221 4e-3 SMART
SAP 252 286 1.29e-8 SMART
low complexity region 326 343 N/A INTRINSIC
low complexity region 371 383 N/A INTRINSIC
coiled coil region 396 435 N/A INTRINSIC
low complexity region 557 573 N/A INTRINSIC
low complexity region 615 629 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000101042
SMART Domains Protein: ENSMUSP00000098603
Gene: ENSMUSG00000020542

DomainStartEndE-ValueType
low complexity region 19 32 N/A INTRINSIC
low complexity region 119 132 N/A INTRINSIC
SCOP:d1lsha3 140 221 4e-3 SMART
SAP 252 286 1.29e-8 SMART
low complexity region 326 343 N/A INTRINSIC
low complexity region 371 383 N/A INTRINSIC
coiled coil region 396 435 N/A INTRINSIC
low complexity region 557 573 N/A INTRINSIC
low complexity region 615 629 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000101042
SMART Domains Protein: ENSMUSP00000098603
Gene: ENSMUSG00000020542

DomainStartEndE-ValueType
low complexity region 19 32 N/A INTRINSIC
low complexity region 119 132 N/A INTRINSIC
SCOP:d1lsha3 140 221 4e-3 SMART
SAP 252 286 1.29e-8 SMART
low complexity region 326 343 N/A INTRINSIC
low complexity region 371 383 N/A INTRINSIC
coiled coil region 396 435 N/A INTRINSIC
low complexity region 557 573 N/A INTRINSIC
low complexity region 615 629 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000101042
SMART Domains Protein: ENSMUSP00000098603
Gene: ENSMUSG00000020542

DomainStartEndE-ValueType
low complexity region 19 32 N/A INTRINSIC
low complexity region 119 132 N/A INTRINSIC
SCOP:d1lsha3 140 221 4e-3 SMART
SAP 252 286 1.29e-8 SMART
low complexity region 326 343 N/A INTRINSIC
low complexity region 371 383 N/A INTRINSIC
coiled coil region 396 435 N/A INTRINSIC
low complexity region 557 573 N/A INTRINSIC
low complexity region 615 629 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000102635
SMART Domains Protein: ENSMUSP00000099695
Gene: ENSMUSG00000020542

DomainStartEndE-ValueType
RPEL 18 43 4e-1 SMART
RPEL 62 87 9.26e0 SMART
RPEL 106 131 1.15e-6 SMART
low complexity region 147 160 N/A INTRINSIC
low complexity region 247 260 N/A INTRINSIC
SCOP:d1lsha3 268 349 4e-3 SMART
SAP 380 414 1.29e-8 SMART
low complexity region 454 471 N/A INTRINSIC
low complexity region 499 511 N/A INTRINSIC
coiled coil region 524 563 N/A INTRINSIC
low complexity region 695 709 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000102635
SMART Domains Protein: ENSMUSP00000099695
Gene: ENSMUSG00000020542

DomainStartEndE-ValueType
RPEL 18 43 4e-1 SMART
RPEL 62 87 9.26e0 SMART
RPEL 106 131 1.15e-6 SMART
low complexity region 147 160 N/A INTRINSIC
low complexity region 247 260 N/A INTRINSIC
SCOP:d1lsha3 268 349 4e-3 SMART
SAP 380 414 1.29e-8 SMART
low complexity region 454 471 N/A INTRINSIC
low complexity region 499 511 N/A INTRINSIC
coiled coil region 524 563 N/A INTRINSIC
low complexity region 695 709 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000102635
SMART Domains Protein: ENSMUSP00000099695
Gene: ENSMUSG00000020542

DomainStartEndE-ValueType
RPEL 18 43 4e-1 SMART
RPEL 62 87 9.26e0 SMART
RPEL 106 131 1.15e-6 SMART
low complexity region 147 160 N/A INTRINSIC
low complexity region 247 260 N/A INTRINSIC
SCOP:d1lsha3 268 349 4e-3 SMART
SAP 380 414 1.29e-8 SMART
low complexity region 454 471 N/A INTRINSIC
low complexity region 499 511 N/A INTRINSIC
coiled coil region 524 563 N/A INTRINSIC
low complexity region 695 709 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108695
SMART Domains Protein: ENSMUSP00000104335
Gene: ENSMUSG00000020542

DomainStartEndE-ValueType
RPEL 18 43 4e-1 SMART
RPEL 62 87 9.26e0 SMART
RPEL 106 131 1.15e-6 SMART
low complexity region 147 160 N/A INTRINSIC
low complexity region 247 260 N/A INTRINSIC
SCOP:d1lsha3 268 349 5e-3 SMART
SAP 380 414 1.29e-8 SMART
low complexity region 454 471 N/A INTRINSIC
low complexity region 499 511 N/A INTRINSIC
coiled coil region 524 563 N/A INTRINSIC
low complexity region 685 701 N/A INTRINSIC
low complexity region 743 757 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108695
SMART Domains Protein: ENSMUSP00000104335
Gene: ENSMUSG00000020542

DomainStartEndE-ValueType
RPEL 18 43 4e-1 SMART
RPEL 62 87 9.26e0 SMART
RPEL 106 131 1.15e-6 SMART
low complexity region 147 160 N/A INTRINSIC
low complexity region 247 260 N/A INTRINSIC
SCOP:d1lsha3 268 349 5e-3 SMART
SAP 380 414 1.29e-8 SMART
low complexity region 454 471 N/A INTRINSIC
low complexity region 499 511 N/A INTRINSIC
coiled coil region 524 563 N/A INTRINSIC
low complexity region 685 701 N/A INTRINSIC
low complexity region 743 757 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108695
SMART Domains Protein: ENSMUSP00000104335
Gene: ENSMUSG00000020542

DomainStartEndE-ValueType
RPEL 18 43 4e-1 SMART
RPEL 62 87 9.26e0 SMART
RPEL 106 131 1.15e-6 SMART
low complexity region 147 160 N/A INTRINSIC
low complexity region 247 260 N/A INTRINSIC
SCOP:d1lsha3 268 349 5e-3 SMART
SAP 380 414 1.29e-8 SMART
low complexity region 454 471 N/A INTRINSIC
low complexity region 499 511 N/A INTRINSIC
coiled coil region 524 563 N/A INTRINSIC
low complexity region 685 701 N/A INTRINSIC
low complexity region 743 757 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151483
Meta Mutation Damage Score 0.622 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 98% (86/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein, which is expressed in heart, aorta, and in smooth muscle cell-containing tissues. It functions as a transcriptional co-activator of serum response factor (SRF) and modulates expression of cardiac and smooth muscle-specific SRF-target genes, and thus may play a crucial role in cardiogenesis and differentiation of the smooth muscle cell lineage. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a null mutation exhibit embryonic lethality and fail to form vascular smooth muscle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim3 C T 18: 61,805,086 V639M probably damaging Het
Adgrf4 A G 17: 42,667,265 S396P probably damaging Het
Aldh3b2 T A 19: 3,978,469 I123N probably damaging Het
Aldh5a1 A G 13: 24,911,584 Y517H probably damaging Het
Aph1c A C 9: 66,827,838 I77S probably damaging Het
Armc8 A G 9: 99,526,889 probably null Het
Atp13a5 G A 16: 29,248,160 P1020L probably damaging Het
BC024139 A T 15: 76,126,066 M80K possibly damaging Het
Cdk5rap1 C T 2: 154,370,956 probably null Het
Cenpn A G 8: 116,934,773 I204V probably damaging Het
Ces4a A T 8: 105,147,158 M420L probably benign Het
Chdh T A 14: 30,033,724 D322E probably benign Het
Clcn6 A T 4: 148,019,766 I223N probably damaging Het
Clec4b1 A G 6: 123,068,469 K50E possibly damaging Het
Creg1 T A 1: 165,769,863 C135* probably null Het
Cyp4f13 C T 17: 32,925,704 R411Q probably damaging Het
Dnah7b T C 1: 46,195,074 F1426L probably damaging Het
Dock9 A T 14: 121,543,505 *1917R probably null Het
Dync1h1 T G 12: 110,639,801 L2435R possibly damaging Het
Eif3l C A 15: 79,081,649 Y166* probably null Het
Emilin1 T A 5: 30,917,784 N456K possibly damaging Het
Fam83f C T 15: 80,692,449 R434C probably damaging Het
Fbxw9 A G 8: 85,060,156 D10G possibly damaging Het
Flt1 C A 5: 147,683,939 A132S probably benign Het
Fsip2 T G 2: 82,990,951 V5676G possibly damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gm11596 A G 11: 99,793,238 probably benign Het
Gm6522 T C 3: 106,275,970 noncoding transcript Het
Gm6728 A G 6: 136,487,074 noncoding transcript Het
Gria4 T A 9: 4,464,295 I556F possibly damaging Het
Grp A T 18: 65,879,970 D69V probably damaging Het
Gucy1a1 G T 3: 82,119,162 probably benign Het
Haus5 A T 7: 30,658,555 L376Q probably damaging Het
Ifne A T 4: 88,879,705 Y159N probably damaging Het
Ift80 A G 3: 68,990,759 V81A probably benign Het
Inpp5b T C 4: 124,751,495 V192A probably benign Het
Kcnh4 A G 11: 100,749,743 S486P probably damaging Het
Kif5b A G 18: 6,222,912 probably benign Het
Macf1 T A 4: 123,433,303 E4800D probably damaging Het
Mblac2 C T 13: 81,711,976 Q150* probably null Het
Mc1r A T 8: 123,407,516 T3S probably benign Het
Med17 G A 9: 15,265,372 Q70* probably null Het
Nphp3 T C 9: 104,031,970 L793P probably benign Het
Olfr1020 T A 2: 85,849,716 M88K probably damaging Het
Olfr1240 T G 2: 89,439,659 T207P possibly damaging Het
Olfr1377 A G 11: 50,985,543 T281A probably damaging Het
Olfr1436 T C 19: 12,298,580 D184G probably damaging Het
Olfr165 A T 16: 19,407,301 F238L probably damaging Het
Olfr891 T A 9: 38,179,900 T308S possibly damaging Het
Piezo1 A T 8: 122,486,921 L1745Q probably damaging Het
Prdm10 T A 9: 31,347,080 H600Q probably damaging Het
Psapl1 C A 5: 36,204,867 L268M probably damaging Het
Psg23 T C 7: 18,612,114 I219V probably benign Het
Rexo5 A T 7: 119,801,330 R113* probably null Het
Rgs22 A T 15: 36,100,212 I243N probably damaging Het
Rhbdf1 G A 11: 32,214,517 T183I probably damaging Het
Rhobtb1 T C 10: 69,270,724 M373T probably benign Het
Ros1 G T 10: 52,172,870 A88E probably damaging Het
Sdr16c6 A G 4: 4,058,834 F251L probably benign Het
Skil A G 3: 31,113,413 Y398C probably damaging Het
Slc22a3 A T 17: 12,464,532 M148K probably benign Het
Slco4c1 G A 1: 96,841,228 P303L probably damaging Het
Sntn A T 14: 13,679,103 K92N probably benign Het
Spry4 A T 18: 38,589,823 S296T probably benign Het
St8sia1 A G 6: 142,829,070 F261S probably damaging Het
Stab2 C T 10: 86,843,500 probably null Het
Stk24 A T 14: 121,293,454 C363* probably null Het
Tank G A 2: 61,578,635 probably benign Het
Tmem67 T C 4: 12,070,262 N387S probably benign Het
Treml1 A T 17: 48,366,857 I304L probably benign Het
Trim13 A G 14: 61,605,517 I328V probably benign Het
Upk2 A G 9: 44,454,085 V62A probably damaging Het
Urb2 A T 8: 124,029,635 K694* probably null Het
Vmn2r17 C A 5: 109,427,119 N97K probably damaging Het
Vmn2r57 A T 7: 41,400,468 V619D probably damaging Het
Vmn2r92 G A 17: 18,167,372 R213Q probably benign Het
Wnt6 G A 1: 74,782,629 C123Y probably damaging Het
Zfp292 A G 4: 34,819,563 I253T probably damaging Het
Zfp52 C T 17: 21,561,243 S451L probably damaging Het
Other mutations in Myocd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Myocd APN 11 65180944 critical splice acceptor site probably null
IGL00481:Myocd APN 11 65187154 missense probably damaging 0.99
IGL00857:Myocd APN 11 65178836 missense possibly damaging 0.93
IGL01012:Myocd APN 11 65184625 missense possibly damaging 0.51
IGL01570:Myocd APN 11 65200807 missense probably benign 0.00
IGL01865:Myocd APN 11 65200897 missense probably benign 0.30
IGL01938:Myocd APN 11 65187088 missense probably damaging 1.00
IGL02324:Myocd APN 11 65178658 missense probably benign 0.01
IGL02598:Myocd APN 11 65183470 missense probably benign 0.31
IGL02886:Myocd APN 11 65178743 missense probably damaging 0.99
IGL03008:Myocd APN 11 65187566 missense probably damaging 0.98
IGL03034:Myocd APN 11 65218685 missense probably benign 0.00
harvey UTSW 11 65179030 splice site probably null
irma UTSW 11 65196394 missense probably damaging 0.97
Nate UTSW 11 65233088 intron probably null
R0078:Myocd UTSW 11 65187464 missense possibly damaging 0.96
R0097:Myocd UTSW 11 65179014 missense possibly damaging 0.67
R0097:Myocd UTSW 11 65179014 missense possibly damaging 0.67
R0234:Myocd UTSW 11 65187240 missense probably benign 0.01
R0234:Myocd UTSW 11 65187240 missense probably benign 0.01
R0453:Myocd UTSW 11 65196225 missense probably damaging 1.00
R0523:Myocd UTSW 11 65180902 missense probably damaging 1.00
R0838:Myocd UTSW 11 65178932 missense probably benign 0.00
R0899:Myocd UTSW 11 65195192 missense possibly damaging 0.50
R1167:Myocd UTSW 11 65196377 missense possibly damaging 0.77
R1472:Myocd UTSW 11 65187504 missense probably benign 0.01
R1508:Myocd UTSW 11 65184516 missense probably damaging 0.98
R1620:Myocd UTSW 11 65196394 missense probably damaging 0.97
R1630:Myocd UTSW 11 65196394 missense probably damaging 0.97
R1731:Myocd UTSW 11 65200888 missense probably benign 0.30
R1740:Myocd UTSW 11 65218521 splice site probably benign
R1769:Myocd UTSW 11 65178701 missense probably benign 0.01
R1823:Myocd UTSW 11 65178670 missense probably benign 0.00
R1968:Myocd UTSW 11 65200907 missense probably damaging 1.00
R1997:Myocd UTSW 11 65204321 nonsense probably null
R2018:Myocd UTSW 11 65187028 missense probably damaging 1.00
R2105:Myocd UTSW 11 65218658 nonsense probably null
R2314:Myocd UTSW 11 65200807 missense probably damaging 1.00
R4330:Myocd UTSW 11 65223764 missense probably benign 0.12
R4331:Myocd UTSW 11 65223764 missense probably benign 0.12
R4603:Myocd UTSW 11 65187745 missense possibly damaging 0.82
R4619:Myocd UTSW 11 65178428 utr 3 prime probably benign
R4631:Myocd UTSW 11 65178859 missense probably benign 0.10
R4974:Myocd UTSW 11 65183473 missense possibly damaging 0.78
R4976:Myocd UTSW 11 65222050 missense probably benign 0.00
R5478:Myocd UTSW 11 65233088 intron probably null
R5499:Myocd UTSW 11 65178749 missense possibly damaging 0.62
R6052:Myocd UTSW 11 65196256 missense probably damaging 1.00
R6356:Myocd UTSW 11 65218570 unclassified probably null
R7144:Myocd UTSW 11 65218648 missense probably damaging 1.00
R7261:Myocd UTSW 11 65187596 missense probably damaging 0.98
R7354:Myocd UTSW 11 65187493 missense probably benign 0.00
R7461:Myocd UTSW 11 65218603 missense probably damaging 1.00
X0057:Myocd UTSW 11 65183445 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- ACTTCCAGGTGTTCGTCACTG -3'
(R):5'- AGCCAGCTGAGAAGAGTTTG -3'

Sequencing Primer
(F):5'- CACTGTCGTTGGCGTAGTGATC -3'
(R):5'- GTAGAGGTCCCAAGGCATG -3'
Posted On2016-03-17