Incidental Mutation 'R4865:Grp'
ID374878
Institutional Source Beutler Lab
Gene Symbol Grp
Ensembl Gene ENSMUSG00000024517
Gene Namegastrin releasing peptide
SynonymsBLP
MMRRC Submission 042475-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4865 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location65872820-65886579 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 65879970 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 69 (D69V)
Ref Sequence ENSEMBL: ENSMUSP00000133437 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025395] [ENSMUST00000173530] [ENSMUST00000173985]
Predicted Effect probably damaging
Transcript: ENSMUST00000025395
AA Change: D69V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000025395
Gene: ENSMUSG00000024517
AA Change: D69V

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Bombesin 43 56 9.1e-10 PFAM
low complexity region 82 95 N/A INTRINSIC
low complexity region 98 112 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000173530
AA Change: D69V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000139014
Gene: ENSMUSG00000024517
AA Change: D69V

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Bombesin 43 56 1.2e-11 PFAM
low complexity region 82 95 N/A INTRINSIC
low complexity region 98 112 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000173985
AA Change: D69V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000133437
Gene: ENSMUSG00000024517
AA Change: D69V

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Bombesin 43 56 3.5e-11 PFAM
low complexity region 82 95 N/A INTRINSIC
low complexity region 98 112 N/A INTRINSIC
Meta Mutation Damage Score 0.0292 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 98% (86/88)
MGI Phenotype FUNCTION: This gene encodes a neuropeptide hormone that affects various biological processes such as neuroendocrine regulation, gastrointestinal secretion, nociception, cell proliferation and inflammation. The encoded protein undergoes proteolytic processing to generate multiple mature peptides with biological activity. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit attenuated scratching response to chloroquine, SLIGRL and BAM8-22. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim3 C T 18: 61,805,086 V639M probably damaging Het
Adgrf4 A G 17: 42,667,265 S396P probably damaging Het
Aldh3b2 T A 19: 3,978,469 I123N probably damaging Het
Aldh5a1 A G 13: 24,911,584 Y517H probably damaging Het
Aph1c A C 9: 66,827,838 I77S probably damaging Het
Armc8 A G 9: 99,526,889 probably null Het
Atp13a5 G A 16: 29,248,160 P1020L probably damaging Het
BC024139 A T 15: 76,126,066 M80K possibly damaging Het
Cdk5rap1 C T 2: 154,370,956 probably null Het
Cenpn A G 8: 116,934,773 I204V probably damaging Het
Ces4a A T 8: 105,147,158 M420L probably benign Het
Chdh T A 14: 30,033,724 D322E probably benign Het
Clcn6 A T 4: 148,019,766 I223N probably damaging Het
Clec4b1 A G 6: 123,068,469 K50E possibly damaging Het
Creg1 T A 1: 165,769,863 C135* probably null Het
Cyp4f13 C T 17: 32,925,704 R411Q probably damaging Het
Dnah7b T C 1: 46,195,074 F1426L probably damaging Het
Dock9 A T 14: 121,543,505 *1917R probably null Het
Dync1h1 T G 12: 110,639,801 L2435R possibly damaging Het
Eif3l C A 15: 79,081,649 Y166* probably null Het
Emilin1 T A 5: 30,917,784 N456K possibly damaging Het
Fam83f C T 15: 80,692,449 R434C probably damaging Het
Fbxw9 A G 8: 85,060,156 D10G possibly damaging Het
Flt1 C A 5: 147,683,939 A132S probably benign Het
Fsip2 T G 2: 82,990,951 V5676G possibly damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gm11596 A G 11: 99,793,238 probably benign Het
Gm6522 T C 3: 106,275,970 noncoding transcript Het
Gm6728 A G 6: 136,487,074 noncoding transcript Het
Gria4 T A 9: 4,464,295 I556F possibly damaging Het
Gucy1a1 G T 3: 82,119,162 probably benign Het
Haus5 A T 7: 30,658,555 L376Q probably damaging Het
Ifne A T 4: 88,879,705 Y159N probably damaging Het
Ift80 A G 3: 68,990,759 V81A probably benign Het
Inpp5b T C 4: 124,751,495 V192A probably benign Het
Kcnh4 A G 11: 100,749,743 S486P probably damaging Het
Kif5b A G 18: 6,222,912 probably benign Het
Macf1 T A 4: 123,433,303 E4800D probably damaging Het
Mblac2 C T 13: 81,711,976 Q150* probably null Het
Mc1r A T 8: 123,407,516 T3S probably benign Het
Med17 G A 9: 15,265,372 Q70* probably null Het
Myocd A T 11: 65,179,030 probably null Het
Nphp3 T C 9: 104,031,970 L793P probably benign Het
Olfr1020 T A 2: 85,849,716 M88K probably damaging Het
Olfr1240 T G 2: 89,439,659 T207P possibly damaging Het
Olfr1377 A G 11: 50,985,543 T281A probably damaging Het
Olfr1436 T C 19: 12,298,580 D184G probably damaging Het
Olfr165 A T 16: 19,407,301 F238L probably damaging Het
Olfr891 T A 9: 38,179,900 T308S possibly damaging Het
Piezo1 A T 8: 122,486,921 L1745Q probably damaging Het
Prdm10 T A 9: 31,347,080 H600Q probably damaging Het
Psapl1 C A 5: 36,204,867 L268M probably damaging Het
Psg23 T C 7: 18,612,114 I219V probably benign Het
Rexo5 A T 7: 119,801,330 R113* probably null Het
Rgs22 A T 15: 36,100,212 I243N probably damaging Het
Rhbdf1 G A 11: 32,214,517 T183I probably damaging Het
Rhobtb1 T C 10: 69,270,724 M373T probably benign Het
Ros1 G T 10: 52,172,870 A88E probably damaging Het
Sdr16c6 A G 4: 4,058,834 F251L probably benign Het
Skil A G 3: 31,113,413 Y398C probably damaging Het
Slc22a3 A T 17: 12,464,532 M148K probably benign Het
Slco4c1 G A 1: 96,841,228 P303L probably damaging Het
Sntn A T 14: 13,679,103 K92N probably benign Het
Spry4 A T 18: 38,589,823 S296T probably benign Het
St8sia1 A G 6: 142,829,070 F261S probably damaging Het
Stab2 C T 10: 86,843,500 probably null Het
Stk24 A T 14: 121,293,454 C363* probably null Het
Tank G A 2: 61,578,635 probably benign Het
Tmem67 T C 4: 12,070,262 N387S probably benign Het
Treml1 A T 17: 48,366,857 I304L probably benign Het
Trim13 A G 14: 61,605,517 I328V probably benign Het
Upk2 A G 9: 44,454,085 V62A probably damaging Het
Urb2 A T 8: 124,029,635 K694* probably null Het
Vmn2r17 C A 5: 109,427,119 N97K probably damaging Het
Vmn2r57 A T 7: 41,400,468 V619D probably damaging Het
Vmn2r92 G A 17: 18,167,372 R213Q probably benign Het
Wnt6 G A 1: 74,782,629 C123Y probably damaging Het
Zfp292 A G 4: 34,819,563 I253T probably damaging Het
Zfp52 C T 17: 21,561,243 S451L probably damaging Het
Other mutations in Grp
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4362001:Grp UTSW 18 65886226 missense probably benign 0.18
R0584:Grp UTSW 18 65873695 missense possibly damaging 0.79
R1144:Grp UTSW 18 65879970 missense probably damaging 0.99
R5085:Grp UTSW 18 65880159 missense probably benign
R6084:Grp UTSW 18 65879937 missense probably damaging 0.99
R6198:Grp UTSW 18 65879986 missense possibly damaging 0.96
R6325:Grp UTSW 18 65873753 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGCAGAGCCCATGTGTTGTG -3'
(R):5'- AACGTCGTTAAAGTAGCTGCCG -3'

Sequencing Primer
(F):5'- CATGTGTTGTGTATAGCCCAAC -3'
(R):5'- GTTAAAGTAGCTGCCGTCCTCG -3'
Posted On2016-03-17