Incidental Mutation 'R4866:Cog6'
ID374893
Institutional Source Beutler Lab
Gene Symbol Cog6
Ensembl Gene ENSMUSG00000027742
Gene Namecomponent of oligomeric golgi complex 6
Synonyms
MMRRC Submission 042476-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4866 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location52981875-53017237 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 53010598 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 173 (T173I)
Ref Sequence ENSEMBL: ENSMUSP00000141339 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036665] [ENSMUST00000193432] [ENSMUST00000195183]
Predicted Effect probably benign
Transcript: ENSMUST00000036665
AA Change: T173I

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000048603
Gene: ENSMUSG00000027742
AA Change: T173I

DomainStartEndE-ValueType
low complexity region 13 26 N/A INTRINSIC
COG6 55 656 N/A SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192788
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193043
Predicted Effect probably benign
Transcript: ENSMUST00000193432
AA Change: T173I

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000141339
Gene: ENSMUSG00000027742
AA Change: T173I

DomainStartEndE-ValueType
low complexity region 13 26 N/A INTRINSIC
COG6 55 625 5e-289 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195183
SMART Domains Protein: ENSMUSP00000141733
Gene: ENSMUSG00000027742

DomainStartEndE-ValueType
low complexity region 13 26 N/A INTRINSIC
Pfam:COG6 39 174 5.5e-32 PFAM
Meta Mutation Damage Score 0.126 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the conserved oligomeric Golgi complex that is required for maintaining normal structure and activity of the Golgi apparatus. The encoded protein is organized with conserved oligomeric Golgi complex components 5, 7 and 8 into a sub-complex referred to as lobe B. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik T A 10: 77,981,579 probably null Het
Abca3 C T 17: 24,374,300 R224C probably damaging Het
Abcc5 A T 16: 20,422,432 M1K probably null Het
Ablim2 C T 5: 35,802,422 R73C possibly damaging Het
Adam5 A C 8: 24,742,156 probably null Het
Adam5 G A 8: 24,781,603 T596I probably damaging Het
Apoa2 T C 1: 171,225,800 probably null Het
Arhgap8 A G 15: 84,741,904 Y60C probably damaging Het
Atad1 A T 19: 32,702,564 H79Q probably benign Het
Atp8a2 T C 14: 59,691,467 D1046G probably damaging Het
Bcam A G 7: 19,765,472 Y209H probably benign Het
Brpf1 G A 6: 113,322,470 V1120I probably damaging Het
Catsperb G A 12: 101,507,949 C302Y probably damaging Het
Cbl A G 9: 44,152,869 V790A probably benign Het
Ccdc60 T C 5: 116,172,490 D171G probably damaging Het
Cd300c2 A T 11: 115,000,981 C22* probably null Het
Cdan1 C A 2: 120,731,447 probably benign Het
Cdk5rap1 C T 2: 154,370,956 probably null Het
Cfap65 T C 1: 74,925,557 D479G probably damaging Het
Cmbl A G 15: 31,585,344 K113E probably benign Het
Cts6 T A 13: 61,202,276 probably null Het
Cyp11a1 G A 9: 58,026,097 V413M probably damaging Het
Cyp2c39 G A 19: 39,513,576 M136I probably benign Het
Dclre1b A T 3: 103,808,096 Y29N probably damaging Het
Depdc1a T A 3: 159,516,127 I236K probably damaging Het
Dhx36 A T 3: 62,472,777 Y833N probably damaging Het
Dopey2 G T 16: 93,763,430 probably null Het
Elovl3 A G 19: 46,132,164 E32G possibly damaging Het
Epcam T C 17: 87,643,621 V212A possibly damaging Het
Fam189a2 A G 19: 23,975,426 S507P possibly damaging Het
Fcrls A T 3: 87,263,466 C4S possibly damaging Het
Galnt16 T C 12: 80,584,077 Y310H probably damaging Het
Gm12789 G A 4: 101,988,985 probably benign Het
Gspt1 C T 16: 11,222,665 R593H possibly damaging Het
Hmcn2 A T 2: 31,389,391 T1802S possibly damaging Het
Igha A G 12: 113,259,509 V166A probably benign Het
Itfg2 A G 6: 128,416,316 probably benign Het
Jund T C 8: 70,699,605 V183A probably damaging Het
Katnb1 T C 8: 95,097,504 S471P possibly damaging Het
Kazn A G 4: 142,104,905 F661S unknown Het
Kif19a G A 11: 114,767,227 M37I probably benign Het
Lgr5 C T 10: 115,452,685 V661I probably benign Het
Lvrn G T 18: 46,893,701 A789S probably damaging Het
Mapk10 T C 5: 102,963,525 D351G probably damaging Het
Mga T A 2: 119,964,054 C2622S possibly damaging Het
Mios T G 6: 8,214,857 F18V probably damaging Het
Mllt6 A G 11: 97,674,459 D575G probably damaging Het
Mmp10 G A 9: 7,508,189 V439M probably damaging Het
Myh4 A G 11: 67,248,627 D590G probably benign Het
Ndufs2 C T 1: 171,247,049 G14R probably benign Het
Olfr286 T A 15: 98,227,490 I52F probably damaging Het
Olfr576 A T 7: 102,965,720 M207L probably benign Het
Olfr684 T C 7: 105,157,307 Y125C possibly damaging Het
Olfr943 A G 9: 39,185,071 K298E probably damaging Het
Plau G T 14: 20,837,804 V39L probably benign Het
Ppp3cb A G 14: 20,523,843 C275R probably damaging Het
Ppp4r4 T G 12: 103,600,447 M51R possibly damaging Het
Ptprt T C 2: 161,560,239 D1023G probably damaging Het
Raly T A 2: 154,861,896 V129E probably damaging Het
Rsph10b A G 5: 143,948,529 E249G probably benign Het
Sart1 A C 19: 5,382,220 L577W probably damaging Het
Senp1 T C 15: 98,066,848 E189G possibly damaging Het
Slc22a2 G T 17: 12,584,429 C50F probably damaging Het
Spem1 A T 11: 69,820,929 V303E probably damaging Het
Tgfb3 A G 12: 86,077,814 V40A possibly damaging Het
Ttl T C 2: 129,081,227 S163P probably damaging Het
Ttll9 C A 2: 153,003,000 N429K probably benign Het
Uggt1 G A 1: 36,202,855 R333* probably null Het
Zfhx2 A G 14: 55,065,536 S1664P possibly damaging Het
Zfp51 T A 17: 21,461,750 D70E possibly damaging Het
Zfp592 T A 7: 81,041,859 V1262E probably damaging Het
Zfp595 C A 13: 67,317,696 G168C probably damaging Het
Zswim9 A T 7: 13,261,169 S354T probably damaging Het
Other mutations in Cog6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01922:Cog6 APN 3 52986425 missense probably benign 0.03
IGL01946:Cog6 APN 3 53002404 intron probably benign
IGL02122:Cog6 APN 3 52998342 missense probably benign 0.04
IGL02589:Cog6 APN 3 53007270 missense probably damaging 1.00
IGL02819:Cog6 APN 3 53009545 missense probably damaging 0.98
R0045:Cog6 UTSW 3 52992750 unclassified probably null
R0045:Cog6 UTSW 3 52992750 unclassified probably null
R0086:Cog6 UTSW 3 52993570 missense probably damaging 0.98
R0545:Cog6 UTSW 3 52996075 missense probably damaging 1.00
R0707:Cog6 UTSW 3 53013862 missense possibly damaging 0.71
R0718:Cog6 UTSW 3 53010629 missense probably benign 0.35
R1169:Cog6 UTSW 3 53013844 missense probably benign 0.30
R1451:Cog6 UTSW 3 53009113 missense possibly damaging 0.78
R1891:Cog6 UTSW 3 52983180 missense probably benign
R2249:Cog6 UTSW 3 53000479 critical splice donor site probably null
R2264:Cog6 UTSW 3 52992911 nonsense probably null
R3745:Cog6 UTSW 3 52992819 missense probably benign 0.05
R4027:Cog6 UTSW 3 53002529 missense possibly damaging 0.95
R4230:Cog6 UTSW 3 52992808 missense probably benign 0.13
R4400:Cog6 UTSW 3 53012941 missense probably benign 0.11
R4551:Cog6 UTSW 3 52998320 missense probably damaging 1.00
R5326:Cog6 UTSW 3 53013816 missense probably null 0.12
R6169:Cog6 UTSW 3 53007301 missense probably benign 0.03
R6273:Cog6 UTSW 3 52996052 missense probably damaging 1.00
R7169:Cog6 UTSW 3 52989966 missense possibly damaging 0.94
R7199:Cog6 UTSW 3 52983189 missense probably benign 0.21
R7243:Cog6 UTSW 3 53002315 missense probably damaging 1.00
R7299:Cog6 UTSW 3 53002507 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CACTCAGCCTGCAAAGTGTG -3'
(R):5'- GCTCTGTTCTCTAAGATACTAAGTCGG -3'

Sequencing Primer
(F):5'- ATATCCTATGTAGATCAGGCTGGCC -3'
(R):5'- ACTAAGTCGGGTATTTACTTTGTCG -3'
Posted On2016-03-17