Incidental Mutation 'R4866:Adam5'
ID374915
Institutional Source Beutler Lab
Gene Symbol Adam5
Ensembl Gene ENSMUSG00000031554
Gene Namea disintegrin and metallopeptidase domain 5
SynonymstMDCII
MMRRC Submission 042476-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R4866 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location24727093-24824369 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 24781603 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 596 (T596I)
Ref Sequence ENSEMBL: ENSMUSP00000147290 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050300] [ENSMUST00000118419] [ENSMUST00000209935]
Predicted Effect probably damaging
Transcript: ENSMUST00000050300
AA Change: T596I

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000052661
Gene: ENSMUSG00000031554
AA Change: T596I

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:Pep_M12B_propep 16 142 1.6e-19 PFAM
Pfam:Reprolysin 185 378 7.7e-59 PFAM
DISIN 397 474 9.1e-42 SMART
ACR 475 618 6.9e-58 SMART
transmembrane domain 695 712 N/A INTRINSIC
low complexity region 718 751 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118419
AA Change: T596I

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112422
Gene: ENSMUSG00000031554
AA Change: T596I

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:Pep_M12B_propep 16 142 4.7e-30 PFAM
Pfam:Reprolysin 185 378 7.9e-56 PFAM
DISIN 397 474 1.78e-39 SMART
ACR 475 618 2.06e-55 SMART
transmembrane domain 695 712 N/A INTRINSIC
low complexity region 718 750 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130939
Predicted Effect unknown
Transcript: ENSMUST00000132180
AA Change: T513I
SMART Domains Protein: ENSMUSP00000121272
Gene: ENSMUSG00000031554
AA Change: T513I

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 1 60 6.7e-14 PFAM
Pfam:Reprolysin 103 296 2.5e-61 PFAM
DISIN 315 392 1.78e-39 SMART
ACR 393 536 2.06e-55 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000209935
AA Change: T596I

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
Meta Mutation Damage Score 0.0356 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. This gene is located in a cluster of related ADAM genes on chromosome 8. Alternative splicing results in multiple transcript variants encoding different isoforms, some of which may undergo similar processing. [provided by RefSeq, May 2016]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik T A 10: 77,981,579 probably null Het
Abca3 C T 17: 24,374,300 R224C probably damaging Het
Abcc5 A T 16: 20,422,432 M1K probably null Het
Ablim2 C T 5: 35,802,422 R73C possibly damaging Het
Apoa2 T C 1: 171,225,800 probably null Het
Arhgap8 A G 15: 84,741,904 Y60C probably damaging Het
Atad1 A T 19: 32,702,564 H79Q probably benign Het
Atp8a2 T C 14: 59,691,467 D1046G probably damaging Het
Bcam A G 7: 19,765,472 Y209H probably benign Het
Brpf1 G A 6: 113,322,470 V1120I probably damaging Het
Catsperb G A 12: 101,507,949 C302Y probably damaging Het
Cbl A G 9: 44,152,869 V790A probably benign Het
Ccdc60 T C 5: 116,172,490 D171G probably damaging Het
Cd300c2 A T 11: 115,000,981 C22* probably null Het
Cdan1 C A 2: 120,731,447 probably benign Het
Cdk5rap1 C T 2: 154,370,956 probably null Het
Cfap65 T C 1: 74,925,557 D479G probably damaging Het
Cmbl A G 15: 31,585,344 K113E probably benign Het
Cog6 G A 3: 53,010,598 T173I probably benign Het
Cts6 T A 13: 61,202,276 probably null Het
Cyp11a1 G A 9: 58,026,097 V413M probably damaging Het
Cyp2c39 G A 19: 39,513,576 M136I probably benign Het
Dclre1b A T 3: 103,808,096 Y29N probably damaging Het
Depdc1a T A 3: 159,516,127 I236K probably damaging Het
Dhx36 A T 3: 62,472,777 Y833N probably damaging Het
Dopey2 G T 16: 93,763,430 probably null Het
Elovl3 A G 19: 46,132,164 E32G possibly damaging Het
Epcam T C 17: 87,643,621 V212A possibly damaging Het
Fam189a2 A G 19: 23,975,426 S507P possibly damaging Het
Fcrls A T 3: 87,263,466 C4S possibly damaging Het
Galnt16 T C 12: 80,584,077 Y310H probably damaging Het
Gm12789 G A 4: 101,988,985 probably benign Het
Gspt1 C T 16: 11,222,665 R593H possibly damaging Het
Hmcn2 A T 2: 31,389,391 T1802S possibly damaging Het
Igha A G 12: 113,259,509 V166A probably benign Het
Itfg2 A G 6: 128,416,316 probably benign Het
Jund T C 8: 70,699,605 V183A probably damaging Het
Katnb1 T C 8: 95,097,504 S471P possibly damaging Het
Kazn A G 4: 142,104,905 F661S unknown Het
Kif19a G A 11: 114,767,227 M37I probably benign Het
Lgr5 C T 10: 115,452,685 V661I probably benign Het
Lvrn G T 18: 46,893,701 A789S probably damaging Het
Mapk10 T C 5: 102,963,525 D351G probably damaging Het
Mga T A 2: 119,964,054 C2622S possibly damaging Het
Mios T G 6: 8,214,857 F18V probably damaging Het
Mllt6 A G 11: 97,674,459 D575G probably damaging Het
Mmp10 G A 9: 7,508,189 V439M probably damaging Het
Myh4 A G 11: 67,248,627 D590G probably benign Het
Ndufs2 C T 1: 171,247,049 G14R probably benign Het
Olfr286 T A 15: 98,227,490 I52F probably damaging Het
Olfr576 A T 7: 102,965,720 M207L probably benign Het
Olfr684 T C 7: 105,157,307 Y125C possibly damaging Het
Olfr943 A G 9: 39,185,071 K298E probably damaging Het
Plau G T 14: 20,837,804 V39L probably benign Het
Ppp3cb A G 14: 20,523,843 C275R probably damaging Het
Ppp4r4 T G 12: 103,600,447 M51R possibly damaging Het
Ptprt T C 2: 161,560,239 D1023G probably damaging Het
Raly T A 2: 154,861,896 V129E probably damaging Het
Rsph10b A G 5: 143,948,529 E249G probably benign Het
Sart1 A C 19: 5,382,220 L577W probably damaging Het
Senp1 T C 15: 98,066,848 E189G possibly damaging Het
Slc22a2 G T 17: 12,584,429 C50F probably damaging Het
Spem1 A T 11: 69,820,929 V303E probably damaging Het
Tgfb3 A G 12: 86,077,814 V40A possibly damaging Het
Ttl T C 2: 129,081,227 S163P probably damaging Het
Ttll9 C A 2: 153,003,000 N429K probably benign Het
Uggt1 G A 1: 36,202,855 R333* probably null Het
Zfhx2 A G 14: 55,065,536 S1664P possibly damaging Het
Zfp51 T A 17: 21,461,750 D70E possibly damaging Het
Zfp592 T A 7: 81,041,859 V1262E probably damaging Het
Zfp595 C A 13: 67,317,696 G168C probably damaging Het
Zswim9 A T 7: 13,261,169 S354T probably damaging Het
Other mutations in Adam5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Adam5 APN 8 24818742 missense probably benign 0.18
IGL01285:Adam5 APN 8 24781594 missense probably benign 0.02
IGL01310:Adam5 APN 8 24742134 intron probably benign
IGL01510:Adam5 APN 8 24804465 missense probably damaging 1.00
IGL01570:Adam5 APN 8 24810823 missense probably damaging 1.00
IGL02017:Adam5 APN 8 24781759 missense probably benign 0.38
IGL02191:Adam5 APN 8 24812423 nonsense probably null
IGL02397:Adam5 APN 8 24744133 intron probably benign
IGL02488:Adam5 APN 8 24792006 missense probably damaging 0.98
IGL02490:Adam5 APN 8 24781704 nonsense probably null
IGL02499:Adam5 APN 8 24781565 critical splice donor site probably null
IGL02539:Adam5 APN 8 24786213 nonsense probably null
IGL02590:Adam5 APN 8 24744135 intron probably benign
IGL02677:Adam5 APN 8 24812379 splice site probably benign
IGL02679:Adam5 APN 8 24806526 missense probably damaging 1.00
IGL02982:Adam5 APN 8 24804431 missense probably benign 0.02
IGL03146:Adam5 APN 8 24804503 missense probably damaging 0.98
IGL03162:Adam5 APN 8 24781604 missense probably benign 0.30
IGL03284:Adam5 APN 8 24786338 splice site probably benign
R0081:Adam5 UTSW 8 24781687 missense probably damaging 1.00
R0377:Adam5 UTSW 8 24747541 missense probably benign 0.08
R0398:Adam5 UTSW 8 24813432 missense probably benign 0.17
R0771:Adam5 UTSW 8 24786299 missense probably benign 0.04
R0925:Adam5 UTSW 8 24812425 missense probably benign 0.09
R1547:Adam5 UTSW 8 24810713 missense probably benign 0.10
R1985:Adam5 UTSW 8 24746739 missense probably benign 0.01
R2115:Adam5 UTSW 8 24744145 intron probably benign
R2125:Adam5 UTSW 8 24815118 missense probably damaging 1.00
R2144:Adam5 UTSW 8 24815480 missense probably benign 0.14
R3151:Adam5 UTSW 8 24781631 missense probably damaging 0.99
R3612:Adam5 UTSW 8 24818089 splice site probably benign
R3844:Adam5 UTSW 8 24813410 missense probably benign 0.12
R3873:Adam5 UTSW 8 24815109 missense probably benign 0.02
R4514:Adam5 UTSW 8 24818136 missense probably damaging 1.00
R4843:Adam5 UTSW 8 24813536 missense probably damaging 1.00
R4866:Adam5 UTSW 8 24742156 splice site probably null
R4900:Adam5 UTSW 8 24742156 splice site probably null
R4900:Adam5 UTSW 8 24781603 missense probably damaging 0.98
R4903:Adam5 UTSW 8 24786232 missense probably damaging 1.00
R4936:Adam5 UTSW 8 24786271 missense probably damaging 1.00
R4964:Adam5 UTSW 8 24786232 missense probably damaging 1.00
R5259:Adam5 UTSW 8 24810834 missense possibly damaging 0.90
R5293:Adam5 UTSW 8 24810706 missense possibly damaging 0.46
R5724:Adam5 UTSW 8 24804495 nonsense probably null
R5859:Adam5 UTSW 8 24813461 missense probably benign
R6004:Adam5 UTSW 8 24781669 missense probably benign 0.04
R6175:Adam5 UTSW 8 24786151 missense probably benign 0.00
R6539:Adam5 UTSW 8 24782600 missense possibly damaging 0.85
R6994:Adam5 UTSW 8 24786246 nonsense probably null
R6996:Adam5 UTSW 8 24806501 missense probably damaging 1.00
R7009:Adam5 UTSW 8 24806438 missense probably benign 0.00
R7115:Adam5 UTSW 8 24781696 missense possibly damaging 0.69
R7127:Adam5 UTSW 8 24810781 missense probably damaging 1.00
X0019:Adam5 UTSW 8 24812443 missense probably benign 0.00
X0022:Adam5 UTSW 8 24813563 critical splice acceptor site probably null
X0027:Adam5 UTSW 8 24818772 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTTTACACTGCAGAGGTG -3'
(R):5'- CTGTGGGAAACTAATCTGTACGTG -3'

Sequencing Primer
(F):5'- CCACTAAAATACTCAGCTCTAGGTG -3'
(R):5'- TCTGTACGTGGCCATTCAAGAAG -3'
Posted On2016-03-17