Incidental Mutation 'R4877:Tubgcp4'
ID374964
Institutional Source Beutler Lab
Gene Symbol Tubgcp4
Ensembl Gene ENSMUSG00000027263
Gene Nametubulin, gamma complex associated protein 4
SynonymsD2Ertd435e, 4932441P04Rik
MMRRC Submission 042486-MU
Accession Numbers

Genbank: NM_153387

Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R4877 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location121170654-121198770 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121189862 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 439 (T439A)
Ref Sequence ENSEMBL: ENSMUSP00000140417 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039541] [ENSMUST00000110647] [ENSMUST00000110648] [ENSMUST00000110657] [ENSMUST00000110658] [ENSMUST00000186659]
Predicted Effect probably benign
Transcript: ENSMUST00000039541
AA Change: T440A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000044049
Gene: ENSMUSG00000027263
AA Change: T440A

DomainStartEndE-ValueType
Pfam:Spc97_Spc98 4 573 2.8e-111 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110647
SMART Domains Protein: ENSMUSP00000106277
Gene: ENSMUSG00000043909

DomainStartEndE-ValueType
low complexity region 136 149 N/A INTRINSIC
low complexity region 158 169 N/A INTRINSIC
low complexity region 647 661 N/A INTRINSIC
low complexity region 1031 1042 N/A INTRINSIC
low complexity region 1099 1112 N/A INTRINSIC
low complexity region 1260 1272 N/A INTRINSIC
low complexity region 1290 1332 N/A INTRINSIC
Pfam:53-BP1_Tudor 1430 1551 2.5e-80 PFAM
low complexity region 1581 1601 N/A INTRINSIC
BRCT 1673 1785 7.13e-1 SMART
BRCT 1813 1901 1.03e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110648
SMART Domains Protein: ENSMUSP00000106278
Gene: ENSMUSG00000043909

DomainStartEndE-ValueType
low complexity region 136 149 N/A INTRINSIC
low complexity region 158 169 N/A INTRINSIC
low complexity region 647 661 N/A INTRINSIC
low complexity region 1031 1042 N/A INTRINSIC
low complexity region 1099 1112 N/A INTRINSIC
low complexity region 1260 1272 N/A INTRINSIC
low complexity region 1290 1332 N/A INTRINSIC
low complexity region 1389 1409 N/A INTRINSIC
Pfam:53-BP1_Tudor 1480 1601 1.5e-80 PFAM
low complexity region 1631 1651 N/A INTRINSIC
BRCT 1723 1835 7.13e-1 SMART
BRCT 1863 1951 1.03e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110657
AA Change: T439A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106285
Gene: ENSMUSG00000027263
AA Change: T439A

DomainStartEndE-ValueType
Pfam:Spc97_Spc98 4 572 3.1e-115 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110658
AA Change: T439A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106286
Gene: ENSMUSG00000027263
AA Change: T439A

DomainStartEndE-ValueType
Pfam:Spc97_Spc98 4 572 4.1e-115 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126817
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135890
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138601
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143305
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144076
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154318
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154633
Predicted Effect probably benign
Transcript: ENSMUST00000186659
AA Change: T439A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000140417
Gene: ENSMUSG00000027263
AA Change: T439A

DomainStartEndE-ValueType
Pfam:Spc97_Spc98 4 572 4.1e-115 PFAM
Meta Mutation Damage Score 0.098 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the gamma-tubulin ring complex, which is required for microtubule nucleation. In mammalian cells, the protein localizes to centrosomes in association with gamma-tubulin. Crystal structure analysis revealed a structure composed of five helical bundles arranged around conserved hydrophobic cores. An exposed surface area located in the C-terminal domain is essential and sufficient for direct binding to gamma-tubulin. Mutations in this gene that alter microtubule organization are associated with microcephaly and chorioretinopathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2015]
Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 A G 11: 94,367,595 Y475H probably damaging Het
Adamts12 G T 15: 11,327,701 G1388V probably damaging Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Arhgap26 T C 18: 39,296,929 probably null Het
Atp7b T A 8: 22,028,601 I74F probably damaging Het
Bod1l A G 5: 41,819,994 Y1326H probably benign Het
Card11 T C 5: 140,885,877 S690G probably damaging Het
Cbx3 A G 6: 51,482,560 E169G possibly damaging Het
Cd28 A T 1: 60,769,702 M192L possibly damaging Het
Chd6 T C 2: 161,029,299 probably benign Het
Cyp2c69 C T 19: 39,877,612 C179Y probably damaging Het
Cyp7b1 A T 3: 18,097,293 V252E probably damaging Het
Dcp2 G T 18: 44,417,592 G378C probably benign Het
Dip2b A T 15: 100,160,529 I196L possibly damaging Het
Erbin G A 13: 103,850,838 P405S probably damaging Het
Etv1 A G 12: 38,831,293 probably null Het
F830104G03Rik T G 3: 56,890,496 K33T unknown Het
Fbln2 C A 6: 91,233,495 H140Q probably damaging Het
Fxr1 A G 3: 34,047,698 T109A probably damaging Het
Gm10110 T C 14: 89,897,349 noncoding transcript Het
Gm9949 C T 18: 62,184,069 probably benign Het
Grin2d A G 7: 45,854,615 L604P probably damaging Het
Gstcd A T 3: 133,005,553 probably benign Het
Ifna16 A G 4: 88,676,444 V138A probably benign Het
Itpr2 T A 6: 146,325,205 N1314I probably damaging Het
Kitl T C 10: 100,080,866 V177A probably damaging Het
L3mbtl1 A T 2: 162,948,568 Q185L probably damaging Het
Lhx9 T A 1: 138,838,354 N232I probably benign Het
Lnx1 T C 5: 74,628,123 R111G probably benign Het
Lrrc41 A G 4: 116,079,405 I72M probably damaging Het
Lrriq1 T A 10: 103,234,038 D39V possibly damaging Het
Lyrm7 A G 11: 54,841,110 probably benign Het
Lyst T A 13: 13,683,149 Y2508N probably damaging Het
Masp2 A T 4: 148,602,871 Y70F probably benign Het
Mc4r T C 18: 66,859,338 I235V probably benign Het
Med12l G A 3: 59,244,793 V1000M probably damaging Het
Morc2b T C 17: 33,138,738 H20R probably benign Het
Ms4a1 A T 19: 11,254,493 S173T probably damaging Het
Myh13 A C 11: 67,337,651 D339A probably damaging Het
Nars A T 18: 64,500,572 Y542* probably null Het
Nectin2 G A 7: 19,717,720 T463I possibly damaging Het
Nrg4 A G 9: 55,259,395 F64L probably benign Het
Nrxn1 T A 17: 91,088,177 I184F probably benign Het
Nxph2 C T 2: 23,399,834 P66L probably benign Het
Olfr1123 C T 2: 87,418,563 Q170* probably null Het
Olfr56 C A 11: 49,134,781 F196L probably damaging Het
Pard3 A T 8: 127,388,537 T579S probably damaging Het
Patj A G 4: 98,569,058 I48V possibly damaging Het
Paxbp1 T C 16: 91,044,311 probably benign Het
Pou2f3 A T 9: 43,139,323 N235K possibly damaging Het
Ppp2r2c A G 5: 36,868,870 D17G probably damaging Het
Rgs8 A G 1: 153,692,887 probably benign Het
Rnd3 A G 2: 51,148,750 V42A probably damaging Het
Rp1l1 A G 14: 64,026,171 R247G probably benign Het
Sec31b A T 19: 44,535,733 V156D probably damaging Het
Slc22a2 T A 17: 12,614,815 Y461N possibly damaging Het
Spag6l T C 16: 16,781,758 K280R possibly damaging Het
Spata31d1a A G 13: 59,702,523 L597P probably damaging Het
Srr G T 11: 74,907,780 probably benign Het
Sry C G Y: 2,662,864 Q265H unknown Het
Tgif1 A C 17: 70,849,705 probably null Het
Tle3 A T 9: 61,373,499 probably benign Het
Twist1 C T 12: 33,958,351 T125M probably damaging Het
Unc13a T A 8: 71,658,616 D317V possibly damaging Het
Vmn1r227 T A 17: 20,735,145 noncoding transcript Het
Vps72 G T 3: 95,118,187 probably benign Het
Zfp184 T C 13: 21,960,328 S735P possibly damaging Het
Zfp42 A T 8: 43,295,688 C259S possibly damaging Het
Zmiz2 A G 11: 6,403,251 H678R probably damaging Het
Other mutations in Tubgcp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00573:Tubgcp4 APN 2 121178701 missense probably damaging 0.99
IGL01112:Tubgcp4 APN 2 121173601 missense probably benign 0.10
IGL01149:Tubgcp4 APN 2 121184783 missense probably null 0.00
IGL01869:Tubgcp4 APN 2 121175788 missense possibly damaging 0.95
IGL01873:Tubgcp4 APN 2 121188184 critical splice donor site probably null
IGL01888:Tubgcp4 APN 2 121184747 missense probably benign 0.15
IGL03060:Tubgcp4 APN 2 121176590
IGL03333:Tubgcp4 APN 2 121196173 unclassified probably null
FR4589:Tubgcp4 UTSW 2 121175463 critical splice donor site probably benign
G5030:Tubgcp4 UTSW 2 121184334 missense probably damaging 1.00
R0482:Tubgcp4 UTSW 2 121175374 missense probably benign 0.02
R0512:Tubgcp4 UTSW 2 121175419 missense probably benign 0.06
R1433:Tubgcp4 UTSW 2 121175424 nonsense probably null
R1488:Tubgcp4 UTSW 2 121176550 missense possibly damaging 0.50
R1699:Tubgcp4 UTSW 2 121189893 nonsense probably null
R1760:Tubgcp4 UTSW 2 121189471 critical splice donor site probably null
R1935:Tubgcp4 UTSW 2 121178666 splice site probably benign
R2249:Tubgcp4 UTSW 2 121183629 missense possibly damaging 0.86
R4093:Tubgcp4 UTSW 2 121195477 missense probably benign 0.01
R4422:Tubgcp4 UTSW 2 121189401 nonsense probably null
R4433:Tubgcp4 UTSW 2 121184473 missense probably benign 0.01
R4541:Tubgcp4 UTSW 2 121195426 missense probably benign 0.01
R4670:Tubgcp4 UTSW 2 121173665 nonsense probably null
R4873:Tubgcp4 UTSW 2 121184849 intron probably benign
R5044:Tubgcp4 UTSW 2 121173580 missense probably damaging 1.00
R5436:Tubgcp4 UTSW 2 121188136 missense probably damaging 1.00
R5436:Tubgcp4 UTSW 2 121194182 missense probably benign 0.01
R5566:Tubgcp4 UTSW 2 121184770 missense possibly damaging 0.61
R6110:Tubgcp4 UTSW 2 121194108 missense probably benign 0.02
R6700:Tubgcp4 UTSW 2 121189848 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- AGCCCTCACAGAAGTTTCCTC -3'
(R):5'- GTAGAAACCAGCTGGACACC -3'

Sequencing Primer
(F):5'- ACAGAAGTTTCCTCCCCTCTAC -3'
(R):5'- ACACCAGGCTGGCTTCTATCAG -3'
Posted On2016-03-17