Incidental Mutation 'R4877:L3mbtl1'
ID374966
Institutional Source Beutler Lab
Gene Symbol L3mbtl1
Ensembl Gene ENSMUSG00000035576
Gene NameL3MBTL1 histone methyl-lysine binding protein
SynonymsL3MBTL1
MMRRC Submission 042486-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.399) question?
Stock #R4877 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location162943472-162974522 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 162948568 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 185 (Q185L)
Ref Sequence ENSEMBL: ENSMUSP00000123217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035751] [ENSMUST00000124264] [ENSMUST00000156954]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035751
AA Change: Q185L

PolyPhen 2 Score 0.558 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000044038
Gene: ENSMUSG00000035576
AA Change: Q185L

DomainStartEndE-ValueType
low complexity region 234 242 N/A INTRINSIC
MBT 280 380 5.34e-53 SMART
MBT 388 487 2.17e-53 SMART
MBT 496 591 1.49e-51 SMART
Pfam:zf-C2HC 627 655 1.7e-17 PFAM
SAM 754 821 3.49e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000124264
AA Change: Q58L

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000116118
Gene: ENSMUSG00000035576
AA Change: Q58L

DomainStartEndE-ValueType
low complexity region 107 115 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125296
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137108
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149447
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153416
Predicted Effect probably damaging
Transcript: ENSMUST00000156954
AA Change: Q185L

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000123217
Gene: ENSMUSG00000035576
AA Change: Q185L

DomainStartEndE-ValueType
low complexity region 234 242 N/A INTRINSIC
Meta Mutation Damage Score 0.244 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene represents a polycomb group gene. The encoded protein functions to regulate gene activity, likely via chromatin modification. The encoded protein may also be necessary for mitosis. Alternatively spliced transcript variants encoding different isoforms have been identified.[provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal nervous system phenotype, hematopoietic system phenotype, immune system phenotype, cellular phenotype, and lifespan. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 A G 11: 94,367,595 Y475H probably damaging Het
Adamts12 G T 15: 11,327,701 G1388V probably damaging Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Arhgap26 T C 18: 39,296,929 probably null Het
Atp7b T A 8: 22,028,601 I74F probably damaging Het
Bod1l A G 5: 41,819,994 Y1326H probably benign Het
Card11 T C 5: 140,885,877 S690G probably damaging Het
Cbx3 A G 6: 51,482,560 E169G possibly damaging Het
Cd28 A T 1: 60,769,702 M192L possibly damaging Het
Chd6 T C 2: 161,029,299 probably benign Het
Cyp2c69 C T 19: 39,877,612 C179Y probably damaging Het
Cyp7b1 A T 3: 18,097,293 V252E probably damaging Het
Dcp2 G T 18: 44,417,592 G378C probably benign Het
Dip2b A T 15: 100,160,529 I196L possibly damaging Het
Erbin G A 13: 103,850,838 P405S probably damaging Het
Etv1 A G 12: 38,831,293 probably null Het
F830104G03Rik T G 3: 56,890,496 K33T unknown Het
Fbln2 C A 6: 91,233,495 H140Q probably damaging Het
Fxr1 A G 3: 34,047,698 T109A probably damaging Het
Gm10110 T C 14: 89,897,349 noncoding transcript Het
Gm9949 C T 18: 62,184,069 probably benign Het
Grin2d A G 7: 45,854,615 L604P probably damaging Het
Gstcd A T 3: 133,005,553 probably benign Het
Ifna16 A G 4: 88,676,444 V138A probably benign Het
Itpr2 T A 6: 146,325,205 N1314I probably damaging Het
Kitl T C 10: 100,080,866 V177A probably damaging Het
Lhx9 T A 1: 138,838,354 N232I probably benign Het
Lnx1 T C 5: 74,628,123 R111G probably benign Het
Lrrc41 A G 4: 116,079,405 I72M probably damaging Het
Lrriq1 T A 10: 103,234,038 D39V possibly damaging Het
Lyrm7 A G 11: 54,841,110 probably benign Het
Lyst T A 13: 13,683,149 Y2508N probably damaging Het
Masp2 A T 4: 148,602,871 Y70F probably benign Het
Mc4r T C 18: 66,859,338 I235V probably benign Het
Med12l G A 3: 59,244,793 V1000M probably damaging Het
Morc2b T C 17: 33,138,738 H20R probably benign Het
Ms4a1 A T 19: 11,254,493 S173T probably damaging Het
Myh13 A C 11: 67,337,651 D339A probably damaging Het
Nars A T 18: 64,500,572 Y542* probably null Het
Nectin2 G A 7: 19,717,720 T463I possibly damaging Het
Nrg4 A G 9: 55,259,395 F64L probably benign Het
Nrxn1 T A 17: 91,088,177 I184F probably benign Het
Nxph2 C T 2: 23,399,834 P66L probably benign Het
Olfr1123 C T 2: 87,418,563 Q170* probably null Het
Olfr56 C A 11: 49,134,781 F196L probably damaging Het
Pard3 A T 8: 127,388,537 T579S probably damaging Het
Patj A G 4: 98,569,058 I48V possibly damaging Het
Paxbp1 T C 16: 91,044,311 probably benign Het
Pou2f3 A T 9: 43,139,323 N235K possibly damaging Het
Ppp2r2c A G 5: 36,868,870 D17G probably damaging Het
Rgs8 A G 1: 153,692,887 probably benign Het
Rnd3 A G 2: 51,148,750 V42A probably damaging Het
Rp1l1 A G 14: 64,026,171 R247G probably benign Het
Sec31b A T 19: 44,535,733 V156D probably damaging Het
Slc22a2 T A 17: 12,614,815 Y461N possibly damaging Het
Spag6l T C 16: 16,781,758 K280R possibly damaging Het
Spata31d1a A G 13: 59,702,523 L597P probably damaging Het
Srr G T 11: 74,907,780 probably benign Het
Sry C G Y: 2,662,864 Q265H unknown Het
Tgif1 A C 17: 70,849,705 probably null Het
Tle3 A T 9: 61,373,499 probably benign Het
Tubgcp4 A G 2: 121,189,862 T439A probably benign Het
Twist1 C T 12: 33,958,351 T125M probably damaging Het
Unc13a T A 8: 71,658,616 D317V possibly damaging Het
Vmn1r227 T A 17: 20,735,145 noncoding transcript Het
Vps72 G T 3: 95,118,187 probably benign Het
Zfp184 T C 13: 21,960,328 S735P possibly damaging Het
Zfp42 A T 8: 43,295,688 C259S possibly damaging Het
Zmiz2 A G 11: 6,403,251 H678R probably damaging Het
Other mutations in L3mbtl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:L3mbtl1 APN 2 162967063 missense probably damaging 1.00
IGL01090:L3mbtl1 APN 2 162966005 missense probably damaging 1.00
IGL01291:L3mbtl1 APN 2 162970180 missense probably benign 0.30
IGL02897:L3mbtl1 APN 2 162965772 missense probably damaging 1.00
IGL02974:L3mbtl1 APN 2 162970183 missense possibly damaging 0.68
IGL02986:L3mbtl1 APN 2 162970305 missense probably damaging 1.00
IGL03057:L3mbtl1 APN 2 162967383 missense probably damaging 1.00
IGL03372:L3mbtl1 APN 2 162971157 splice site probably benign
ANU05:L3mbtl1 UTSW 2 162970180 missense probably benign 0.30
R0006:L3mbtl1 UTSW 2 162964569 missense possibly damaging 0.94
R0006:L3mbtl1 UTSW 2 162964569 missense possibly damaging 0.94
R0067:L3mbtl1 UTSW 2 162948828 missense probably damaging 1.00
R0067:L3mbtl1 UTSW 2 162948828 missense probably damaging 1.00
R0078:L3mbtl1 UTSW 2 162947226 missense probably benign 0.12
R0505:L3mbtl1 UTSW 2 162947335 splice site probably benign
R0748:L3mbtl1 UTSW 2 162971163 splice site probably benign
R0748:L3mbtl1 UTSW 2 162971164 critical splice acceptor site probably null
R0761:L3mbtl1 UTSW 2 162966047 missense probably damaging 1.00
R1789:L3mbtl1 UTSW 2 162974502 missense probably benign
R1970:L3mbtl1 UTSW 2 162959572 missense probably damaging 1.00
R2114:L3mbtl1 UTSW 2 162960070 splice site probably null
R2115:L3mbtl1 UTSW 2 162960070 splice site probably null
R2116:L3mbtl1 UTSW 2 162960070 splice site probably null
R2117:L3mbtl1 UTSW 2 162960070 splice site probably null
R2513:L3mbtl1 UTSW 2 162967585 missense probably benign
R3848:L3mbtl1 UTSW 2 162948201 missense probably damaging 1.00
R4930:L3mbtl1 UTSW 2 162965772 missense probably damaging 1.00
R5930:L3mbtl1 UTSW 2 162967336 small deletion probably benign
R5932:L3mbtl1 UTSW 2 162967336 small deletion probably benign
R6562:L3mbtl1 UTSW 2 162970204 missense probably benign 0.28
R6601:L3mbtl1 UTSW 2 162948175 start gained probably benign
Predicted Primers PCR Primer
(F):5'- AAGGCTGGATGATGCTGTCC -3'
(R):5'- AGCCTGAGTTCTCTACTATGACTG -3'

Sequencing Primer
(F):5'- CTGGATGATGCTGTCCAGTAG -3'
(R):5'- TCTACTATGACTGACCTACAAACGG -3'
Posted On2016-03-17