Incidental Mutation 'R4877:Cyp7b1'
ID374967
Institutional Source Beutler Lab
Gene Symbol Cyp7b1
Ensembl Gene ENSMUSG00000039519
Gene Namecytochrome P450, family 7, subfamily b, polypeptide 1
SynonymsD3Ertd552e, hct-1
MMRRC Submission 042486-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4877 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location18071950-18243338 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 18097293 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 252 (V252E)
Ref Sequence ENSEMBL: ENSMUSP00000037487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035625]
Predicted Effect probably damaging
Transcript: ENSMUST00000035625
AA Change: V252E

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000037487
Gene: ENSMUSG00000039519
AA Change: V252E

DomainStartEndE-ValueType
transmembrane domain 15 34 N/A INTRINSIC
Pfam:p450 44 496 1e-52 PFAM
Meta Mutation Damage Score 0.0388 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This endoplasmic reticulum membrane protein catalyzes the first reaction in the cholesterol catabolic pathway of extrahepatic tissues, which converts cholesterol to bile acids. This enzyme likely plays a minor role in total bile acid synthesis, but may also be involved in the development of atherosclerosis, neurosteroid metabolism and sex hormone synthesis. Mutations in this gene have been associated with hereditary spastic paraplegia (SPG5 or HSP), an autosomal recessive disorder. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a knock-out allele show significantly increased levels of 25- and 27-hydroxycholesterol, and reduced IgA levels. Female mice homozygous for a reporter allele display early onset of puberty and early ovarian failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 A G 11: 94,367,595 Y475H probably damaging Het
Adamts12 G T 15: 11,327,701 G1388V probably damaging Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Arhgap26 T C 18: 39,296,929 probably null Het
Atp7b T A 8: 22,028,601 I74F probably damaging Het
Bod1l A G 5: 41,819,994 Y1326H probably benign Het
Card11 T C 5: 140,885,877 S690G probably damaging Het
Cbx3 A G 6: 51,482,560 E169G possibly damaging Het
Cd28 A T 1: 60,769,702 M192L possibly damaging Het
Chd6 T C 2: 161,029,299 probably benign Het
Cyp2c69 C T 19: 39,877,612 C179Y probably damaging Het
Dcp2 G T 18: 44,417,592 G378C probably benign Het
Dip2b A T 15: 100,160,529 I196L possibly damaging Het
Erbin G A 13: 103,850,838 P405S probably damaging Het
Etv1 A G 12: 38,831,293 probably null Het
F830104G03Rik T G 3: 56,890,496 K33T unknown Het
Fbln2 C A 6: 91,233,495 H140Q probably damaging Het
Fxr1 A G 3: 34,047,698 T109A probably damaging Het
Gm10110 T C 14: 89,897,349 noncoding transcript Het
Gm9949 C T 18: 62,184,069 probably benign Het
Grin2d A G 7: 45,854,615 L604P probably damaging Het
Gstcd A T 3: 133,005,553 probably benign Het
Ifna16 A G 4: 88,676,444 V138A probably benign Het
Itpr2 T A 6: 146,325,205 N1314I probably damaging Het
Kitl T C 10: 100,080,866 V177A probably damaging Het
L3mbtl1 A T 2: 162,948,568 Q185L probably damaging Het
Lhx9 T A 1: 138,838,354 N232I probably benign Het
Lnx1 T C 5: 74,628,123 R111G probably benign Het
Lrrc41 A G 4: 116,079,405 I72M probably damaging Het
Lrriq1 T A 10: 103,234,038 D39V possibly damaging Het
Lyrm7 A G 11: 54,841,110 probably benign Het
Lyst T A 13: 13,683,149 Y2508N probably damaging Het
Masp2 A T 4: 148,602,871 Y70F probably benign Het
Mc4r T C 18: 66,859,338 I235V probably benign Het
Med12l G A 3: 59,244,793 V1000M probably damaging Het
Morc2b T C 17: 33,138,738 H20R probably benign Het
Ms4a1 A T 19: 11,254,493 S173T probably damaging Het
Myh13 A C 11: 67,337,651 D339A probably damaging Het
Nars A T 18: 64,500,572 Y542* probably null Het
Nectin2 G A 7: 19,717,720 T463I possibly damaging Het
Nrg4 A G 9: 55,259,395 F64L probably benign Het
Nrxn1 T A 17: 91,088,177 I184F probably benign Het
Nxph2 C T 2: 23,399,834 P66L probably benign Het
Olfr1123 C T 2: 87,418,563 Q170* probably null Het
Olfr56 C A 11: 49,134,781 F196L probably damaging Het
Pard3 A T 8: 127,388,537 T579S probably damaging Het
Patj A G 4: 98,569,058 I48V possibly damaging Het
Paxbp1 T C 16: 91,044,311 probably benign Het
Pou2f3 A T 9: 43,139,323 N235K possibly damaging Het
Ppp2r2c A G 5: 36,868,870 D17G probably damaging Het
Rgs8 A G 1: 153,692,887 probably benign Het
Rnd3 A G 2: 51,148,750 V42A probably damaging Het
Rp1l1 A G 14: 64,026,171 R247G probably benign Het
Sec31b A T 19: 44,535,733 V156D probably damaging Het
Slc22a2 T A 17: 12,614,815 Y461N possibly damaging Het
Spag6l T C 16: 16,781,758 K280R possibly damaging Het
Spata31d1a A G 13: 59,702,523 L597P probably damaging Het
Srr G T 11: 74,907,780 probably benign Het
Sry C G Y: 2,662,864 Q265H unknown Het
Tgif1 A C 17: 70,849,705 probably null Het
Tle3 A T 9: 61,373,499 probably benign Het
Tubgcp4 A G 2: 121,189,862 T439A probably benign Het
Twist1 C T 12: 33,958,351 T125M probably damaging Het
Unc13a T A 8: 71,658,616 D317V possibly damaging Het
Vmn1r227 T A 17: 20,735,145 noncoding transcript Het
Vps72 G T 3: 95,118,187 probably benign Het
Zfp184 T C 13: 21,960,328 S735P possibly damaging Het
Zfp42 A T 8: 43,295,688 C259S possibly damaging Het
Zmiz2 A G 11: 6,403,251 H678R probably damaging Het
Other mutations in Cyp7b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02728:Cyp7b1 APN 3 18072575 missense probably damaging 1.00
R0166:Cyp7b1 UTSW 3 18097366 missense probably benign 0.23
R0334:Cyp7b1 UTSW 3 18103796 missense probably damaging 1.00
R0417:Cyp7b1 UTSW 3 18096691 missense probably damaging 1.00
R0696:Cyp7b1 UTSW 3 18072585 missense probably benign 0.23
R0894:Cyp7b1 UTSW 3 18097510 missense probably benign 0.00
R1799:Cyp7b1 UTSW 3 18097452 missense probably benign 0.01
R1893:Cyp7b1 UTSW 3 18096567 missense possibly damaging 0.57
R4538:Cyp7b1 UTSW 3 18097581 missense possibly damaging 0.71
R4692:Cyp7b1 UTSW 3 18072564 missense probably damaging 0.97
R5382:Cyp7b1 UTSW 3 18097221 missense possibly damaging 0.53
R5841:Cyp7b1 UTSW 3 18097506 missense probably damaging 1.00
R6867:Cyp7b1 UTSW 3 18097230 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCTTCTGAAGTCTAATTTTCTGC -3'
(R):5'- TGCATTCTGTGGCTCACTGG -3'

Sequencing Primer
(F):5'- GGAGTAAATGCCACTTAGTTATACTC -3'
(R):5'- GGCTCACTGGTATTTGAGATCAC -3'
Posted On2016-03-17