Mutagenetix > Incidental Mutations

Incidental Mutation 'R4877:Cyp7b1'

374967

Institutional Source

Beutler Lab

Gene Symbol

Cyp7b1

Ensembl Gene

ENSMUSG00000039519

Gene Name

cytochrome P450, family 7, subfamily b, polypeptide 1

Synonyms

D3Ertd552e, hct-1

MMRRC Submission

042486-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4877 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

18071950-18243338 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 18097293 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 252 (V252E)

Ref Sequence

ENSEMBL: ENSMUSP00000037487 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035625]

Predicted Effect

probably damaging
Transcript: ENSMUST00000035625
AA Change: V252E

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000037487
Gene: ENSMUSG00000039519
AA Change: V252E

Domain	Start	End	E-Value	Type
transmembrane domain	15	34	N/A	INTRINSIC
Pfam:p450	44	496	1e-52	PFAM

Meta Mutation Damage Score

0.0388

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.8%
20x: 93.8%

Validation Efficiency

100% (76/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This endoplasmic reticulum membrane protein catalyzes the first reaction in the cholesterol catabolic pathway of extrahepatic tissues, which converts cholesterol to bile acids. This enzyme likely plays a minor role in total bile acid synthesis, but may also be involved in the development of atherosclerosis, neurosteroid metabolism and sex hormone synthesis. Mutations in this gene have been associated with hereditary spastic paraplegia (SPG5 or HSP), an autosomal recessive disorder. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a knock-out allele show significantly increased levels of 25- and 27-hydroxycholesterol, and reduced IgA levels. Female mice homozygous for a reporter allele display early onset of puberty and early ovarian failure. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc3	A	G	11: 94,367,595	Y475H	probably damaging	Het
Adamts12	G	T	15: 11,327,701	G1388V	probably damaging	Het
Anks6	C	T	4: 47,030,795	G601S	probably damaging	Het
Arhgap26	T	C	18: 39,296,929		probably null	Het
Atp7b	T	A	8: 22,028,601	I74F	probably damaging	Het
Bod1l	A	G	5: 41,819,994	Y1326H	probably benign	Het
Card11	T	C	5: 140,885,877	S690G	probably damaging	Het
Cbx3	A	G	6: 51,482,560	E169G	possibly damaging	Het
Cd28	A	T	1: 60,769,702	M192L	possibly damaging	Het
Chd6	T	C	2: 161,029,299		probably benign	Het
Cyp2c69	C	T	19: 39,877,612	C179Y	probably damaging	Het
Dcp2	G	T	18: 44,417,592	G378C	probably benign	Het
Dip2b	A	T	15: 100,160,529	I196L	possibly damaging	Het
Erbin	G	A	13: 103,850,838	P405S	probably damaging	Het
Etv1	A	G	12: 38,831,293		probably null	Het
F830104G03Rik	T	G	3: 56,890,496	K33T	unknown	Het
Fbln2	C	A	6: 91,233,495	H140Q	probably damaging	Het
Fxr1	A	G	3: 34,047,698	T109A	probably damaging	Het
Gm10110	T	C	14: 89,897,349		noncoding transcript	Het
Gm9949	C	T	18: 62,184,069		probably benign	Het
Grin2d	A	G	7: 45,854,615	L604P	probably damaging	Het
Gstcd	A	T	3: 133,005,553		probably benign	Het
Ifna16	A	G	4: 88,676,444	V138A	probably benign	Het
Itpr2	T	A	6: 146,325,205	N1314I	probably damaging	Het
Kitl	T	C	10: 100,080,866	V177A	probably damaging	Het
L3mbtl1	A	T	2: 162,948,568	Q185L	probably damaging	Het
Lhx9	T	A	1: 138,838,354	N232I	probably benign	Het
Lnx1	T	C	5: 74,628,123	R111G	probably benign	Het
Lrrc41	A	G	4: 116,079,405	I72M	probably damaging	Het
Lrriq1	T	A	10: 103,234,038	D39V	possibly damaging	Het
Lyrm7	A	G	11: 54,841,110		probably benign	Het
Lyst	T	A	13: 13,683,149	Y2508N	probably damaging	Het
Masp2	A	T	4: 148,602,871	Y70F	probably benign	Het
Mc4r	T	C	18: 66,859,338	I235V	probably benign	Het
Med12l	G	A	3: 59,244,793	V1000M	probably damaging	Het
Morc2b	T	C	17: 33,138,738	H20R	probably benign	Het
Ms4a1	A	T	19: 11,254,493	S173T	probably damaging	Het
Myh13	A	C	11: 67,337,651	D339A	probably damaging	Het
Nars	A	T	18: 64,500,572	Y542*	probably null	Het
Nectin2	G	A	7: 19,717,720	T463I	possibly damaging	Het
Nrg4	A	G	9: 55,259,395	F64L	probably benign	Het
Nrxn1	T	A	17: 91,088,177	I184F	probably benign	Het
Nxph2	C	T	2: 23,399,834	P66L	probably benign	Het
Olfr1123	C	T	2: 87,418,563	Q170*	probably null	Het
Olfr56	C	A	11: 49,134,781	F196L	probably damaging	Het
Pard3	A	T	8: 127,388,537	T579S	probably damaging	Het
Patj	A	G	4: 98,569,058	I48V	possibly damaging	Het
Paxbp1	T	C	16: 91,044,311		probably benign	Het
Pou2f3	A	T	9: 43,139,323	N235K	possibly damaging	Het
Ppp2r2c	A	G	5: 36,868,870	D17G	probably damaging	Het
Rgs8	A	G	1: 153,692,887		probably benign	Het
Rnd3	A	G	2: 51,148,750	V42A	probably damaging	Het
Rp1l1	A	G	14: 64,026,171	R247G	probably benign	Het
Sec31b	A	T	19: 44,535,733	V156D	probably damaging	Het
Slc22a2	T	A	17: 12,614,815	Y461N	possibly damaging	Het
Spag6l	T	C	16: 16,781,758	K280R	possibly damaging	Het
Spata31d1a	A	G	13: 59,702,523	L597P	probably damaging	Het
Srr	G	T	11: 74,907,780		probably benign	Het
Sry	C	G	Y: 2,662,864	Q265H	unknown	Het
Tgif1	A	C	17: 70,849,705		probably null	Het
Tle3	A	T	9: 61,373,499		probably benign	Het
Tubgcp4	A	G	2: 121,189,862	T439A	probably benign	Het
Twist1	C	T	12: 33,958,351	T125M	probably damaging	Het
Unc13a	T	A	8: 71,658,616	D317V	possibly damaging	Het
Vmn1r227	T	A	17: 20,735,145		noncoding transcript	Het
Vps72	G	T	3: 95,118,187		probably benign	Het
Zfp184	T	C	13: 21,960,328	S735P	possibly damaging	Het
Zfp42	A	T	8: 43,295,688	C259S	possibly damaging	Het
Zmiz2	A	G	11: 6,403,251	H678R	probably damaging	Het

Other mutations in Cyp7b1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02728:Cyp7b1	APN	3	18072575	missense	probably damaging	1.00
R0166:Cyp7b1	UTSW	3	18097366	missense	probably benign	0.23
R0334:Cyp7b1	UTSW	3	18103796	missense	probably damaging	1.00
R0417:Cyp7b1	UTSW	3	18096691	missense	probably damaging	1.00
R0696:Cyp7b1	UTSW	3	18072585	missense	probably benign	0.23
R0894:Cyp7b1	UTSW	3	18097510	missense	probably benign	0.00
R1799:Cyp7b1	UTSW	3	18097452	missense	probably benign	0.01
R1893:Cyp7b1	UTSW	3	18096567	missense	possibly damaging	0.57
R4538:Cyp7b1	UTSW	3	18097581	missense	possibly damaging	0.71
R4692:Cyp7b1	UTSW	3	18072564	missense	probably damaging	0.97
R5382:Cyp7b1	UTSW	3	18097221	missense	possibly damaging	0.53
R5841:Cyp7b1	UTSW	3	18097506	missense	probably damaging	1.00
R6867:Cyp7b1	UTSW	3	18097230	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGCTTCTGAAGTCTAATTTTCTGC -3'
(R):5'- TGCATTCTGTGGCTCACTGG -3'

Sequencing Primer
(F):5'- GGAGTAAATGCCACTTAGTTATACTC -3'
(R):5'- GGCTCACTGGTATTTGAGATCAC -3'

Posted On

2016-03-17