Incidental Mutation 'R4877:Pard3'
ID374994
Institutional Source Beutler Lab
Gene Symbol Pard3
Ensembl Gene ENSMUSG00000025812
Gene Namepar-3 family cell polarity regulator
SynonymsASIP, PAR-3, Pard3a, Par3, D8Ertd580e
MMRRC Submission 042486-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4877 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location127063893-127612286 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 127388537 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 579 (T579S)
Ref Sequence ENSEMBL: ENSMUSP00000124319 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026921] [ENSMUST00000079777] [ENSMUST00000108752] [ENSMUST00000159537] [ENSMUST00000160272] [ENSMUST00000160581] [ENSMUST00000160717] [ENSMUST00000160766] [ENSMUST00000161355] [ENSMUST00000162176] [ENSMUST00000162309] [ENSMUST00000162456] [ENSMUST00000162531] [ENSMUST00000162536] [ENSMUST00000162602] [ENSMUST00000162907]
Predicted Effect probably damaging
Transcript: ENSMUST00000026921
AA Change: T579S

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000026921
Gene: ENSMUSG00000025812
AA Change: T579S

DomainStartEndE-ValueType
Pfam:DUF3534 1 146 1.1e-72 PFAM
low complexity region 234 246 N/A INTRINSIC
PDZ 282 361 2.34e-6 SMART
low complexity region 431 440 N/A INTRINSIC
PDZ 469 548 4.1e-20 SMART
PDZ 599 684 9.87e-14 SMART
low complexity region 771 781 N/A INTRINSIC
PDB:4DC2|Z 810 837 3e-10 PDB
low complexity region 863 875 N/A INTRINSIC
low complexity region 892 902 N/A INTRINSIC
low complexity region 921 950 N/A INTRINSIC
low complexity region 965 1005 N/A INTRINSIC
low complexity region 1162 1200 N/A INTRINSIC
low complexity region 1264 1281 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000079777
AA Change: T444S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000078710
Gene: ENSMUSG00000025812
AA Change: T444S

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
PDZ 147 226 2.34e-6 SMART
low complexity region 296 305 N/A INTRINSIC
PDZ 334 413 4.1e-20 SMART
PDZ 464 549 9.87e-14 SMART
low complexity region 636 646 N/A INTRINSIC
PDB:4DC2|Z 675 702 2e-10 PDB
low complexity region 743 755 N/A INTRINSIC
low complexity region 772 782 N/A INTRINSIC
low complexity region 801 830 N/A INTRINSIC
low complexity region 845 885 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108752
AA Change: T444S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104383
Gene: ENSMUSG00000025812
AA Change: T444S

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
PDZ 147 226 2.34e-6 SMART
low complexity region 296 305 N/A INTRINSIC
PDZ 334 413 4.1e-20 SMART
PDZ 464 549 9.87e-14 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000159537
AA Change: T522S

PolyPhen 2 Score 0.669 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000124934
Gene: ENSMUSG00000025812
AA Change: T522S

DomainStartEndE-ValueType
Pfam:DUF3534 1 146 6.7e-73 PFAM
PDZ 238 317 2.34e-6 SMART
low complexity region 387 396 N/A INTRINSIC
PDZ 425 504 4.1e-20 SMART
PDZ 542 627 9.87e-14 SMART
low complexity region 717 727 N/A INTRINSIC
PDB:4DC2|Z 756 783 2e-10 PDB
low complexity region 823 835 N/A INTRINSIC
low complexity region 852 862 N/A INTRINSIC
low complexity region 881 910 N/A INTRINSIC
low complexity region 925 943 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160272
AA Change: T579S

PolyPhen 2 Score 0.365 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000125453
Gene: ENSMUSG00000025812
AA Change: T579S

DomainStartEndE-ValueType
Pfam:DUF3534 1 146 1.7e-60 PFAM
low complexity region 234 246 N/A INTRINSIC
PDZ 282 361 2.34e-6 SMART
low complexity region 431 440 N/A INTRINSIC
PDZ 469 548 4.1e-20 SMART
PDZ 599 684 9.87e-14 SMART
low complexity region 771 781 N/A INTRINSIC
PDB:4DC2|Z 810 837 4e-10 PDB
low complexity region 878 890 N/A INTRINSIC
low complexity region 907 917 N/A INTRINSIC
low complexity region 936 965 N/A INTRINSIC
low complexity region 980 1020 N/A INTRINSIC
low complexity region 1177 1215 N/A INTRINSIC
low complexity region 1279 1296 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000160581
AA Change: T569S

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000124141
Gene: ENSMUSG00000025812
AA Change: T569S

DomainStartEndE-ValueType
Pfam:DUF3534 4 149 7.1e-73 PFAM
low complexity region 237 249 N/A INTRINSIC
PDZ 285 364 2.34e-6 SMART
low complexity region 434 443 N/A INTRINSIC
PDZ 472 551 4.1e-20 SMART
PDZ 589 674 9.87e-14 SMART
low complexity region 764 774 N/A INTRINSIC
low complexity region 841 853 N/A INTRINSIC
low complexity region 870 880 N/A INTRINSIC
low complexity region 899 928 N/A INTRINSIC
low complexity region 943 983 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160593
Predicted Effect probably benign
Transcript: ENSMUST00000160717
AA Change: T444S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125612
Gene: ENSMUSG00000025812
AA Change: T444S

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
PDZ 147 226 2.34e-6 SMART
low complexity region 296 305 N/A INTRINSIC
PDZ 334 413 4.1e-20 SMART
PDZ 464 549 9.87e-14 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000160766
AA Change: T522S

PolyPhen 2 Score 0.830 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000124533
Gene: ENSMUSG00000025812
AA Change: T522S

DomainStartEndE-ValueType
Pfam:DUF3534 1 146 1e-72 PFAM
PDZ 238 317 2.34e-6 SMART
low complexity region 387 396 N/A INTRINSIC
PDZ 425 504 4.1e-20 SMART
PDZ 542 627 9.87e-14 SMART
low complexity region 714 724 N/A INTRINSIC
low complexity region 791 803 N/A INTRINSIC
low complexity region 820 830 N/A INTRINSIC
low complexity region 849 878 N/A INTRINSIC
low complexity region 893 933 N/A INTRINSIC
low complexity region 1090 1128 N/A INTRINSIC
low complexity region 1192 1209 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000161277
AA Change: T497S
SMART Domains Protein: ENSMUSP00000124789
Gene: ENSMUSG00000025812
AA Change: T497S

DomainStartEndE-ValueType
Pfam:DUF3534 3 122 9.6e-37 PFAM
PDZ 214 293 2.34e-6 SMART
low complexity region 363 372 N/A INTRINSIC
PDZ 401 480 4.1e-20 SMART
PDZ 518 603 9.87e-14 SMART
low complexity region 693 703 N/A INTRINSIC
PDB:4DC2|Z 732 759 2e-10 PDB
low complexity region 799 811 N/A INTRINSIC
low complexity region 828 838 N/A INTRINSIC
low complexity region 857 886 N/A INTRINSIC
low complexity region 901 919 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161355
AA Change: T579S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125064
Gene: ENSMUSG00000025812
AA Change: T579S

DomainStartEndE-ValueType
Pfam:DUF3534 1 146 7.2e-73 PFAM
low complexity region 234 246 N/A INTRINSIC
PDZ 282 361 2.34e-6 SMART
low complexity region 431 440 N/A INTRINSIC
PDZ 469 548 4.1e-20 SMART
PDZ 599 684 9.87e-14 SMART
low complexity region 771 781 N/A INTRINSIC
low complexity region 847 859 N/A INTRINSIC
low complexity region 876 886 N/A INTRINSIC
low complexity region 905 934 N/A INTRINSIC
low complexity region 949 989 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162176
AA Change: T301S

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000123944
Gene: ENSMUSG00000025812
AA Change: T301S

DomainStartEndE-ValueType
PDZ 1 83 4.11e-2 SMART
low complexity region 153 162 N/A INTRINSIC
PDZ 191 270 4.1e-20 SMART
PDZ 321 406 9.87e-14 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000162309
AA Change: T579S

PolyPhen 2 Score 0.496 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000124282
Gene: ENSMUSG00000025812
AA Change: T579S

DomainStartEndE-ValueType
Pfam:DUF3534 1 146 6.2e-73 PFAM
low complexity region 234 246 N/A INTRINSIC
PDZ 282 361 2.34e-6 SMART
low complexity region 431 440 N/A INTRINSIC
PDZ 469 548 4.1e-20 SMART
PDZ 599 684 9.87e-14 SMART
low complexity region 771 781 N/A INTRINSIC
PDB:4DC2|Z 810 837 4e-10 PDB
low complexity region 877 889 N/A INTRINSIC
low complexity region 906 916 N/A INTRINSIC
low complexity region 935 964 N/A INTRINSIC
low complexity region 979 1019 N/A INTRINSIC
low complexity region 1176 1214 N/A INTRINSIC
low complexity region 1278 1295 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162456
AA Change: T444S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124162
Gene: ENSMUSG00000025812
AA Change: T444S

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
PDZ 147 226 2.34e-6 SMART
low complexity region 296 305 N/A INTRINSIC
PDZ 334 413 4.1e-20 SMART
PDZ 464 549 9.87e-14 SMART
low complexity region 636 646 N/A INTRINSIC
PDB:4DC2|Z 675 702 2e-10 PDB
low complexity region 743 755 N/A INTRINSIC
low complexity region 772 782 N/A INTRINSIC
low complexity region 801 830 N/A INTRINSIC
low complexity region 845 885 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162531
AA Change: T566S

PolyPhen 2 Score 0.275 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000125610
Gene: ENSMUSG00000025812
AA Change: T566S

DomainStartEndE-ValueType
Pfam:DUF3534 1 146 8.4e-73 PFAM
low complexity region 234 246 N/A INTRINSIC
PDZ 282 361 2.34e-6 SMART
low complexity region 431 440 N/A INTRINSIC
PDZ 469 548 4.1e-20 SMART
PDZ 586 671 9.87e-14 SMART
low complexity region 761 771 N/A INTRINSIC
low complexity region 838 850 N/A INTRINSIC
low complexity region 867 877 N/A INTRINSIC
low complexity region 896 925 N/A INTRINSIC
low complexity region 940 980 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162536
AA Change: T535S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125212
Gene: ENSMUSG00000025812
AA Change: T535S

DomainStartEndE-ValueType
Pfam:DUF3534 1 146 1e-72 PFAM
PDZ 238 317 2.34e-6 SMART
low complexity region 387 396 N/A INTRINSIC
PDZ 425 504 4.1e-20 SMART
PDZ 555 640 9.87e-14 SMART
low complexity region 727 737 N/A INTRINSIC
PDB:4DC2|Z 766 793 3e-10 PDB
low complexity region 833 845 N/A INTRINSIC
low complexity region 862 872 N/A INTRINSIC
low complexity region 891 920 N/A INTRINSIC
low complexity region 935 975 N/A INTRINSIC
low complexity region 1132 1170 N/A INTRINSIC
low complexity region 1234 1251 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000162602
AA Change: T579S

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000125450
Gene: ENSMUSG00000025812
AA Change: T579S

DomainStartEndE-ValueType
Pfam:DUF3534 1 146 7.6e-73 PFAM
low complexity region 234 246 N/A INTRINSIC
PDZ 282 361 2.34e-6 SMART
low complexity region 431 440 N/A INTRINSIC
PDZ 469 548 4.1e-20 SMART
PDZ 599 684 9.87e-14 SMART
low complexity region 774 784 N/A INTRINSIC
PDB:4DC2|Z 813 840 2e-10 PDB
low complexity region 881 893 N/A INTRINSIC
low complexity region 910 920 N/A INTRINSIC
low complexity region 939 968 N/A INTRINSIC
low complexity region 983 1023 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000162665
AA Change: T598S
SMART Domains Protein: ENSMUSP00000124718
Gene: ENSMUSG00000025812
AA Change: T598S

DomainStartEndE-ValueType
Pfam:DUF3534 21 166 1.4e-60 PFAM
low complexity region 254 266 N/A INTRINSIC
PDZ 302 381 2.34e-6 SMART
low complexity region 451 460 N/A INTRINSIC
PDZ 489 568 4.1e-20 SMART
PDZ 619 704 9.87e-14 SMART
low complexity region 791 801 N/A INTRINSIC
low complexity region 868 880 N/A INTRINSIC
low complexity region 897 907 N/A INTRINSIC
low complexity region 926 955 N/A INTRINSIC
low complexity region 970 1010 N/A INTRINSIC
low complexity region 1167 1205 N/A INTRINSIC
low complexity region 1269 1286 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162727
SMART Domains Protein: ENSMUSP00000124359
Gene: ENSMUSG00000025812

DomainStartEndE-ValueType
Blast:PDZ 2 56 8e-30 BLAST
PDB:2KOH|A 2 61 4e-35 PDB
SCOP:d1qaua_ 4 55 3e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000162907
AA Change: T579S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124319
Gene: ENSMUSG00000025812
AA Change: T579S

DomainStartEndE-ValueType
Pfam:DUF3534 1 146 4.6e-73 PFAM
low complexity region 234 246 N/A INTRINSIC
PDZ 282 361 2.34e-6 SMART
low complexity region 431 440 N/A INTRINSIC
PDZ 469 548 4.1e-20 SMART
PDZ 599 684 9.87e-14 SMART
Meta Mutation Damage Score 0.378 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the PARD protein family. PARD family members interact with other PARD family members and other proteins; they affect asymmetrical cell division and direct polarized cell growth. Multiple alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality at E12.5 associated with growth retardation, abnormal heart development, and abnormal epicardial cell development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 A G 11: 94,367,595 Y475H probably damaging Het
Adamts12 G T 15: 11,327,701 G1388V probably damaging Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Arhgap26 T C 18: 39,296,929 probably null Het
Atp7b T A 8: 22,028,601 I74F probably damaging Het
Bod1l A G 5: 41,819,994 Y1326H probably benign Het
Card11 T C 5: 140,885,877 S690G probably damaging Het
Cbx3 A G 6: 51,482,560 E169G possibly damaging Het
Cd28 A T 1: 60,769,702 M192L possibly damaging Het
Chd6 T C 2: 161,029,299 probably benign Het
Cyp2c69 C T 19: 39,877,612 C179Y probably damaging Het
Cyp7b1 A T 3: 18,097,293 V252E probably damaging Het
Dcp2 G T 18: 44,417,592 G378C probably benign Het
Dip2b A T 15: 100,160,529 I196L possibly damaging Het
Erbin G A 13: 103,850,838 P405S probably damaging Het
Etv1 A G 12: 38,831,293 probably null Het
F830104G03Rik T G 3: 56,890,496 K33T unknown Het
Fbln2 C A 6: 91,233,495 H140Q probably damaging Het
Fxr1 A G 3: 34,047,698 T109A probably damaging Het
Gm10110 T C 14: 89,897,349 noncoding transcript Het
Gm9949 C T 18: 62,184,069 probably benign Het
Grin2d A G 7: 45,854,615 L604P probably damaging Het
Gstcd A T 3: 133,005,553 probably benign Het
Ifna16 A G 4: 88,676,444 V138A probably benign Het
Itpr2 T A 6: 146,325,205 N1314I probably damaging Het
Kitl T C 10: 100,080,866 V177A probably damaging Het
L3mbtl1 A T 2: 162,948,568 Q185L probably damaging Het
Lhx9 T A 1: 138,838,354 N232I probably benign Het
Lnx1 T C 5: 74,628,123 R111G probably benign Het
Lrrc41 A G 4: 116,079,405 I72M probably damaging Het
Lrriq1 T A 10: 103,234,038 D39V possibly damaging Het
Lyrm7 A G 11: 54,841,110 probably benign Het
Lyst T A 13: 13,683,149 Y2508N probably damaging Het
Masp2 A T 4: 148,602,871 Y70F probably benign Het
Mc4r T C 18: 66,859,338 I235V probably benign Het
Med12l G A 3: 59,244,793 V1000M probably damaging Het
Morc2b T C 17: 33,138,738 H20R probably benign Het
Ms4a1 A T 19: 11,254,493 S173T probably damaging Het
Myh13 A C 11: 67,337,651 D339A probably damaging Het
Nars A T 18: 64,500,572 Y542* probably null Het
Nectin2 G A 7: 19,717,720 T463I possibly damaging Het
Nrg4 A G 9: 55,259,395 F64L probably benign Het
Nrxn1 T A 17: 91,088,177 I184F probably benign Het
Nxph2 C T 2: 23,399,834 P66L probably benign Het
Olfr1123 C T 2: 87,418,563 Q170* probably null Het
Olfr56 C A 11: 49,134,781 F196L probably damaging Het
Patj A G 4: 98,569,058 I48V possibly damaging Het
Paxbp1 T C 16: 91,044,311 probably benign Het
Pou2f3 A T 9: 43,139,323 N235K possibly damaging Het
Ppp2r2c A G 5: 36,868,870 D17G probably damaging Het
Rgs8 A G 1: 153,692,887 probably benign Het
Rnd3 A G 2: 51,148,750 V42A probably damaging Het
Rp1l1 A G 14: 64,026,171 R247G probably benign Het
Sec31b A T 19: 44,535,733 V156D probably damaging Het
Slc22a2 T A 17: 12,614,815 Y461N possibly damaging Het
Spag6l T C 16: 16,781,758 K280R possibly damaging Het
Spata31d1a A G 13: 59,702,523 L597P probably damaging Het
Srr G T 11: 74,907,780 probably benign Het
Sry C G Y: 2,662,864 Q265H unknown Het
Tgif1 A C 17: 70,849,705 probably null Het
Tle3 A T 9: 61,373,499 probably benign Het
Tubgcp4 A G 2: 121,189,862 T439A probably benign Het
Twist1 C T 12: 33,958,351 T125M probably damaging Het
Unc13a T A 8: 71,658,616 D317V possibly damaging Het
Vmn1r227 T A 17: 20,735,145 noncoding transcript Het
Vps72 G T 3: 95,118,187 probably benign Het
Zfp184 T C 13: 21,960,328 S735P possibly damaging Het
Zfp42 A T 8: 43,295,688 C259S possibly damaging Het
Zmiz2 A G 11: 6,403,251 H678R probably damaging Het
Other mutations in Pard3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Pard3 APN 8 127359818 splice site probably benign
IGL00484:Pard3 APN 8 127371846 missense probably benign 0.05
IGL00674:Pard3 APN 8 127388678 missense probably damaging 1.00
IGL01471:Pard3 APN 8 127378246 missense probably benign 0.01
IGL01505:Pard3 APN 8 127324063 missense probably damaging 1.00
IGL02252:Pard3 APN 8 127398756 missense probably benign 0.09
IGL02511:Pard3 APN 8 127161320 splice site probably benign
IGL02838:Pard3 APN 8 127426647 missense probably damaging 0.99
IGL02948:Pard3 APN 8 127306494 missense probably benign 0.00
IGL02987:Pard3 APN 8 127389491 missense probably damaging 0.98
IGL03037:Pard3 APN 8 127306494 missense probably benign 0.00
IGL03084:Pard3 APN 8 127593092 missense probably damaging 0.96
R0025:Pard3 UTSW 8 127161308 missense probably damaging 1.00
R0025:Pard3 UTSW 8 127161308 missense probably damaging 1.00
R0029:Pard3 UTSW 8 127426758 splice site probably benign
R0109:Pard3 UTSW 8 127398666 missense probably damaging 1.00
R0309:Pard3 UTSW 8 127376897 splice site probably benign
R0415:Pard3 UTSW 8 127610566 missense probably damaging 1.00
R0507:Pard3 UTSW 8 127371486 splice site probably benign
R1055:Pard3 UTSW 8 127378280 missense probably benign 0.34
R1305:Pard3 UTSW 8 127306410 missense possibly damaging 0.62
R1619:Pard3 UTSW 8 127380502 missense probably benign 0.02
R1855:Pard3 UTSW 8 127447812 splice site probably null
R2001:Pard3 UTSW 8 127064347 utr 5 prime probably null
R2060:Pard3 UTSW 8 127398604 missense probably benign 0.05
R2064:Pard3 UTSW 8 127610611 missense probably damaging 1.00
R2113:Pard3 UTSW 8 127388537 missense probably damaging 1.00
R2136:Pard3 UTSW 8 127376885 critical splice donor site probably null
R2224:Pard3 UTSW 8 127359776 missense probably damaging 1.00
R2252:Pard3 UTSW 8 127610599 missense probably damaging 1.00
R3870:Pard3 UTSW 8 127409686 missense probably damaging 1.00
R4154:Pard3 UTSW 8 127474396 missense probably damaging 1.00
R4212:Pard3 UTSW 8 127610458 missense probably benign 0.43
R4243:Pard3 UTSW 8 127371647 missense probably benign 0.09
R4523:Pard3 UTSW 8 127398627 missense probably benign 0.08
R4857:Pard3 UTSW 8 127324054 missense probably damaging 0.98
R4876:Pard3 UTSW 8 127561469 intron probably benign
R5197:Pard3 UTSW 8 127073290 splice site probably null
R5215:Pard3 UTSW 8 127378264 missense probably damaging 1.00
R5279:Pard3 UTSW 8 127460386 critical splice donor site probably null
R5349:Pard3 UTSW 8 127415743 missense probably damaging 1.00
R5479:Pard3 UTSW 8 127370355 missense probably damaging 1.00
R5514:Pard3 UTSW 8 127426605 missense probably damaging 1.00
R5681:Pard3 UTSW 8 127389433 missense possibly damaging 0.81
R5934:Pard3 UTSW 8 127389338 missense probably damaging 1.00
R6034:Pard3 UTSW 8 127064327 utr 5 prime probably benign
R6034:Pard3 UTSW 8 127064327 utr 5 prime probably benign
R6187:Pard3 UTSW 8 127073273 missense probably benign 0.00
R6382:Pard3 UTSW 8 127376783 missense probably damaging 1.00
R6774:Pard3 UTSW 8 127410747 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGATGTAAGCATGGCCTGAAGC -3'
(R):5'- CGGCTCTTACTTTAGATGCAGC -3'

Sequencing Primer
(F):5'- ATCTTGAAAGCCAGTTGTGCC -3'
(R):5'- GATGCAGCTCCACCATTGATAATG -3'
Posted On2016-03-17