Incidental Mutation 'R4877:Lyrm7'
ID375003
Institutional Source Beutler Lab
Gene Symbol Lyrm7
Ensembl Gene ENSMUSG00000020268
Gene NameLYR motif containing 7
Synonyms
MMRRC Submission 042486-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.186) question?
Stock #R4877 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location54826866-54860916 bp(-) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) A to G at 54841110 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000141703] [ENSMUST00000144164] [ENSMUST00000148070]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124351
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127887
Predicted Effect probably benign
Transcript: ENSMUST00000141703
SMART Domains Protein: ENSMUSP00000121259
Gene: ENSMUSG00000020268

DomainStartEndE-ValueType
Pfam:Complex1_LYR 5 58 3.5e-13 PFAM
Pfam:Complex1_LYR_1 5 58 8.9e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144164
SMART Domains Protein: ENSMUSP00000120778
Gene: ENSMUSG00000020268

DomainStartEndE-ValueType
Pfam:Complex1_LYR 5 62 1.1e-12 PFAM
Pfam:Complex1_LYR_1 5 69 1.6e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148070
SMART Domains Protein: ENSMUSP00000118373
Gene: ENSMUSG00000020268

DomainStartEndE-ValueType
Pfam:Complex1_LYR 5 62 8.4e-14 PFAM
Pfam:Complex1_LYR_1 5 82 2.9e-13 PFAM
Meta Mutation Damage Score 0.0948 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Inner mitochondrial membrane complex III (CIII) is the main enzyme complex in the mitochondrial respiratory chain, and Rieske Fe-S protein (UQCRFS1) is the last catalytic subunit added to the complex. The protein encoded by this gene is a nuclear-encoded mitochondrial matrix protein that stabilizes UQCRFS1 and chaperones it to the CIII complex. Defects in this gene are a cause of mitochondrial complex III deficiency, nuclear type 8. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jun 2014]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 A G 11: 94,367,595 Y475H probably damaging Het
Adamts12 G T 15: 11,327,701 G1388V probably damaging Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Arhgap26 T C 18: 39,296,929 probably null Het
Atp7b T A 8: 22,028,601 I74F probably damaging Het
Bod1l A G 5: 41,819,994 Y1326H probably benign Het
Card11 T C 5: 140,885,877 S690G probably damaging Het
Cbx3 A G 6: 51,482,560 E169G possibly damaging Het
Cd28 A T 1: 60,769,702 M192L possibly damaging Het
Chd6 T C 2: 161,029,299 probably benign Het
Cyp2c69 C T 19: 39,877,612 C179Y probably damaging Het
Cyp7b1 A T 3: 18,097,293 V252E probably damaging Het
Dcp2 G T 18: 44,417,592 G378C probably benign Het
Dip2b A T 15: 100,160,529 I196L possibly damaging Het
Erbin G A 13: 103,850,838 P405S probably damaging Het
Etv1 A G 12: 38,831,293 probably null Het
F830104G03Rik T G 3: 56,890,496 K33T unknown Het
Fbln2 C A 6: 91,233,495 H140Q probably damaging Het
Fxr1 A G 3: 34,047,698 T109A probably damaging Het
Gm10110 T C 14: 89,897,349 noncoding transcript Het
Gm9949 C T 18: 62,184,069 probably benign Het
Grin2d A G 7: 45,854,615 L604P probably damaging Het
Gstcd A T 3: 133,005,553 probably benign Het
Ifna16 A G 4: 88,676,444 V138A probably benign Het
Itpr2 T A 6: 146,325,205 N1314I probably damaging Het
Kitl T C 10: 100,080,866 V177A probably damaging Het
L3mbtl1 A T 2: 162,948,568 Q185L probably damaging Het
Lhx9 T A 1: 138,838,354 N232I probably benign Het
Lnx1 T C 5: 74,628,123 R111G probably benign Het
Lrrc41 A G 4: 116,079,405 I72M probably damaging Het
Lrriq1 T A 10: 103,234,038 D39V possibly damaging Het
Lyst T A 13: 13,683,149 Y2508N probably damaging Het
Masp2 A T 4: 148,602,871 Y70F probably benign Het
Mc4r T C 18: 66,859,338 I235V probably benign Het
Med12l G A 3: 59,244,793 V1000M probably damaging Het
Morc2b T C 17: 33,138,738 H20R probably benign Het
Ms4a1 A T 19: 11,254,493 S173T probably damaging Het
Myh13 A C 11: 67,337,651 D339A probably damaging Het
Nars A T 18: 64,500,572 Y542* probably null Het
Nectin2 G A 7: 19,717,720 T463I possibly damaging Het
Nrg4 A G 9: 55,259,395 F64L probably benign Het
Nrxn1 T A 17: 91,088,177 I184F probably benign Het
Nxph2 C T 2: 23,399,834 P66L probably benign Het
Olfr1123 C T 2: 87,418,563 Q170* probably null Het
Olfr56 C A 11: 49,134,781 F196L probably damaging Het
Pard3 A T 8: 127,388,537 T579S probably damaging Het
Patj A G 4: 98,569,058 I48V possibly damaging Het
Paxbp1 T C 16: 91,044,311 probably benign Het
Pou2f3 A T 9: 43,139,323 N235K possibly damaging Het
Ppp2r2c A G 5: 36,868,870 D17G probably damaging Het
Rgs8 A G 1: 153,692,887 probably benign Het
Rnd3 A G 2: 51,148,750 V42A probably damaging Het
Rp1l1 A G 14: 64,026,171 R247G probably benign Het
Sec31b A T 19: 44,535,733 V156D probably damaging Het
Slc22a2 T A 17: 12,614,815 Y461N possibly damaging Het
Spag6l T C 16: 16,781,758 K280R possibly damaging Het
Spata31d1a A G 13: 59,702,523 L597P probably damaging Het
Srr G T 11: 74,907,780 probably benign Het
Sry C G Y: 2,662,864 Q265H unknown Het
Tgif1 A C 17: 70,849,705 probably null Het
Tle3 A T 9: 61,373,499 probably benign Het
Tubgcp4 A G 2: 121,189,862 T439A probably benign Het
Twist1 C T 12: 33,958,351 T125M probably damaging Het
Unc13a T A 8: 71,658,616 D317V possibly damaging Het
Vmn1r227 T A 17: 20,735,145 noncoding transcript Het
Vps72 G T 3: 95,118,187 probably benign Het
Zfp184 T C 13: 21,960,328 S735P possibly damaging Het
Zfp42 A T 8: 43,295,688 C259S possibly damaging Het
Zmiz2 A G 11: 6,403,251 H678R probably damaging Het
Other mutations in Lyrm7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03114:Lyrm7 APN 11 54850372 missense possibly damaging 0.69
R0006:Lyrm7 UTSW 11 54848597 missense probably benign 0.04
R1467:Lyrm7 UTSW 11 54850389 missense probably damaging 1.00
R1467:Lyrm7 UTSW 11 54850389 missense probably damaging 1.00
R1519:Lyrm7 UTSW 11 54848599 missense possibly damaging 0.65
R4655:Lyrm7 UTSW 11 54848608 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCAAACAGCTTTGGAAGAC -3'
(R):5'- TTAGAACTGCTGGGGAGACG -3'

Sequencing Primer
(F):5'- TGGAAGACCAAAAGACCTACCAAAGG -3'
(R):5'- CTGGGGAGACGGATGTGC -3'
Posted On2016-03-17