Incidental Mutation 'R4877:Abcc3'
ID375006
Institutional Source Beutler Lab
Gene Symbol Abcc3
Ensembl Gene ENSMUSG00000020865
Gene NameATP-binding cassette, sub-family C (CFTR/MRP), member 3
SynonymsMRP3, 1700019L09Rik
MMRRC Submission 042486-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4877 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location94343295-94392997 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 94367595 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 475 (Y475H)
Ref Sequence ENSEMBL: ENSMUSP00000136343 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021231] [ENSMUST00000178136]
Predicted Effect probably damaging
Transcript: ENSMUST00000021231
AA Change: Y475H

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000021231
Gene: ENSMUSG00000020865
AA Change: Y475H

DomainStartEndE-ValueType
transmembrane domain 35 57 N/A INTRINSIC
transmembrane domain 64 86 N/A INTRINSIC
transmembrane domain 101 123 N/A INTRINSIC
transmembrane domain 130 152 N/A INTRINSIC
transmembrane domain 172 190 N/A INTRINSIC
Pfam:ABC_membrane 310 581 4.4e-43 PFAM
AAA 652 827 2.77e-10 SMART
Pfam:ABC_membrane 963 1235 3.2e-46 PFAM
AAA 1310 1495 2.66e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151124
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155253
Predicted Effect probably damaging
Transcript: ENSMUST00000178136
AA Change: Y475H

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000136343
Gene: ENSMUSG00000020865
AA Change: Y475H

DomainStartEndE-ValueType
transmembrane domain 35 57 N/A INTRINSIC
transmembrane domain 64 86 N/A INTRINSIC
transmembrane domain 101 123 N/A INTRINSIC
transmembrane domain 130 152 N/A INTRINSIC
transmembrane domain 172 190 N/A INTRINSIC
Pfam:ABC_membrane 310 581 4.8e-34 PFAM
AAA 652 827 2.77e-10 SMART
coiled coil region 854 883 N/A INTRINSIC
Pfam:ABC_membrane 967 1236 8.6e-48 PFAM
AAA 1311 1496 2.66e-12 SMART
Meta Mutation Damage Score 0.024 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. The specific function of this protein has not yet been determined; however, this protein may play a role in the transport of biliary and intestinal excretion of organic anions. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene exhibit increased liver bile acid levels after bile duct ligation [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts12 G T 15: 11,327,701 G1388V probably damaging Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Arhgap26 T C 18: 39,296,929 probably null Het
Atp7b T A 8: 22,028,601 I74F probably damaging Het
Bod1l A G 5: 41,819,994 Y1326H probably benign Het
Card11 T C 5: 140,885,877 S690G probably damaging Het
Cbx3 A G 6: 51,482,560 E169G possibly damaging Het
Cd28 A T 1: 60,769,702 M192L possibly damaging Het
Chd6 T C 2: 161,029,299 probably benign Het
Cyp2c69 C T 19: 39,877,612 C179Y probably damaging Het
Cyp7b1 A T 3: 18,097,293 V252E probably damaging Het
Dcp2 G T 18: 44,417,592 G378C probably benign Het
Dip2b A T 15: 100,160,529 I196L possibly damaging Het
Erbin G A 13: 103,850,838 P405S probably damaging Het
Etv1 A G 12: 38,831,293 probably null Het
F830104G03Rik T G 3: 56,890,496 K33T unknown Het
Fbln2 C A 6: 91,233,495 H140Q probably damaging Het
Fxr1 A G 3: 34,047,698 T109A probably damaging Het
Gm10110 T C 14: 89,897,349 noncoding transcript Het
Gm9949 C T 18: 62,184,069 probably benign Het
Grin2d A G 7: 45,854,615 L604P probably damaging Het
Gstcd A T 3: 133,005,553 probably benign Het
Ifna16 A G 4: 88,676,444 V138A probably benign Het
Itpr2 T A 6: 146,325,205 N1314I probably damaging Het
Kitl T C 10: 100,080,866 V177A probably damaging Het
L3mbtl1 A T 2: 162,948,568 Q185L probably damaging Het
Lhx9 T A 1: 138,838,354 N232I probably benign Het
Lnx1 T C 5: 74,628,123 R111G probably benign Het
Lrrc41 A G 4: 116,079,405 I72M probably damaging Het
Lrriq1 T A 10: 103,234,038 D39V possibly damaging Het
Lyrm7 A G 11: 54,841,110 probably benign Het
Lyst T A 13: 13,683,149 Y2508N probably damaging Het
Masp2 A T 4: 148,602,871 Y70F probably benign Het
Mc4r T C 18: 66,859,338 I235V probably benign Het
Med12l G A 3: 59,244,793 V1000M probably damaging Het
Morc2b T C 17: 33,138,738 H20R probably benign Het
Ms4a1 A T 19: 11,254,493 S173T probably damaging Het
Myh13 A C 11: 67,337,651 D339A probably damaging Het
Nars A T 18: 64,500,572 Y542* probably null Het
Nectin2 G A 7: 19,717,720 T463I possibly damaging Het
Nrg4 A G 9: 55,259,395 F64L probably benign Het
Nrxn1 T A 17: 91,088,177 I184F probably benign Het
Nxph2 C T 2: 23,399,834 P66L probably benign Het
Olfr1123 C T 2: 87,418,563 Q170* probably null Het
Olfr56 C A 11: 49,134,781 F196L probably damaging Het
Pard3 A T 8: 127,388,537 T579S probably damaging Het
Patj A G 4: 98,569,058 I48V possibly damaging Het
Paxbp1 T C 16: 91,044,311 probably benign Het
Pou2f3 A T 9: 43,139,323 N235K possibly damaging Het
Ppp2r2c A G 5: 36,868,870 D17G probably damaging Het
Rgs8 A G 1: 153,692,887 probably benign Het
Rnd3 A G 2: 51,148,750 V42A probably damaging Het
Rp1l1 A G 14: 64,026,171 R247G probably benign Het
Sec31b A T 19: 44,535,733 V156D probably damaging Het
Slc22a2 T A 17: 12,614,815 Y461N possibly damaging Het
Spag6l T C 16: 16,781,758 K280R possibly damaging Het
Spata31d1a A G 13: 59,702,523 L597P probably damaging Het
Srr G T 11: 74,907,780 probably benign Het
Sry C G Y: 2,662,864 Q265H unknown Het
Tgif1 A C 17: 70,849,705 probably null Het
Tle3 A T 9: 61,373,499 probably benign Het
Tubgcp4 A G 2: 121,189,862 T439A probably benign Het
Twist1 C T 12: 33,958,351 T125M probably damaging Het
Unc13a T A 8: 71,658,616 D317V possibly damaging Het
Vmn1r227 T A 17: 20,735,145 noncoding transcript Het
Vps72 G T 3: 95,118,187 probably benign Het
Zfp184 T C 13: 21,960,328 S735P possibly damaging Het
Zfp42 A T 8: 43,295,688 C259S possibly damaging Het
Zmiz2 A G 11: 6,403,251 H678R probably damaging Het
Other mutations in Abcc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01147:Abcc3 APN 11 94343785 splice site probably benign
IGL01154:Abcc3 APN 11 94359232 splice site probably benign
IGL01353:Abcc3 APN 11 94352108 missense possibly damaging 0.88
IGL02553:Abcc3 APN 11 94351924 missense probably damaging 1.00
IGL02795:Abcc3 APN 11 94361642 splice site probably benign
IGL02928:Abcc3 APN 11 94361306 missense possibly damaging 0.49
IGL02964:Abcc3 APN 11 94351810 missense possibly damaging 0.93
IGL03006:Abcc3 APN 11 94368595 missense probably benign 0.18
IGL03345:Abcc3 APN 11 94359337 missense probably damaging 1.00
R0200:Abcc3 UTSW 11 94355074 missense probably damaging 0.96
R0377:Abcc3 UTSW 11 94375096 missense possibly damaging 0.90
R0812:Abcc3 UTSW 11 94375202 splice site probably benign
R1269:Abcc3 UTSW 11 94357384 missense probably damaging 1.00
R1270:Abcc3 UTSW 11 94357384 missense probably damaging 1.00
R1375:Abcc3 UTSW 11 94352216 missense possibly damaging 0.46
R1506:Abcc3 UTSW 11 94357318 missense possibly damaging 0.89
R1525:Abcc3 UTSW 11 94361236 missense probably benign 0.00
R1842:Abcc3 UTSW 11 94359612 missense probably benign 0.00
R1868:Abcc3 UTSW 11 94364063 missense probably benign 0.06
R2069:Abcc3 UTSW 11 94364417 missense probably damaging 1.00
R2132:Abcc3 UTSW 11 94367600 missense probably benign 0.18
R2257:Abcc3 UTSW 11 94363594 missense probably damaging 1.00
R2395:Abcc3 UTSW 11 94357306 missense possibly damaging 0.90
R2930:Abcc3 UTSW 11 94361810 missense probably damaging 0.99
R3081:Abcc3 UTSW 11 94356976 missense probably damaging 1.00
R3824:Abcc3 UTSW 11 94368620 critical splice acceptor site probably null
R4385:Abcc3 UTSW 11 94368239 missense probably damaging 0.99
R4425:Abcc3 UTSW 11 94346044 missense probably damaging 0.98
R4464:Abcc3 UTSW 11 94358786 missense probably benign 0.01
R4696:Abcc3 UTSW 11 94350991 missense probably benign 0.01
R5172:Abcc3 UTSW 11 94375608 missense probably damaging 1.00
R5586:Abcc3 UTSW 11 94364421 missense probably damaging 1.00
R5682:Abcc3 UTSW 11 94392897 missense probably benign 0.31
R5719:Abcc3 UTSW 11 94351068 missense probably damaging 1.00
R5816:Abcc3 UTSW 11 94343737 missense probably damaging 0.99
R5919:Abcc3 UTSW 11 94357306 missense possibly damaging 0.90
R6222:Abcc3 UTSW 11 94368605 missense probably benign 0.21
R6264:Abcc3 UTSW 11 94373998 missense probably damaging 0.99
R6526:Abcc3 UTSW 11 94359372 missense probably benign 0.21
R6782:Abcc3 UTSW 11 94358950 missense probably damaging 1.00
R6889:Abcc3 UTSW 11 94375555 missense possibly damaging 0.49
R6953:Abcc3 UTSW 11 94374835 missense probably benign 0.03
X0064:Abcc3 UTSW 11 94363498 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACTGCCTCAGTTACTCTGGC -3'
(R):5'- TTCTCCAAGGGTGCTACTGG -3'

Sequencing Primer
(F):5'- GGTCTCATTGCTGTGAAATTAGAC -3'
(R):5'- AAGGGTGCTACTGGCCATCTG -3'
Posted On2016-03-17