Incidental Mutation 'R0281:Hectd4'
ID37514
Institutional Source Beutler Lab
Gene Symbol Hectd4
Ensembl Gene ENSMUSG00000042744
Gene NameHECT domain E3 ubiquitin protein ligase 4
SynonymsGm15800
MMRRC Submission 038503-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.424) question?
Stock #R0281 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location121220219-121368577 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 121254251 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 193 (D193N)
Ref Sequence ENSEMBL: ENSMUSP00000048345 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042614]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042614
AA Change: D193N

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000048345
Gene: ENSMUSG00000042744
AA Change: D193N

DomainStartEndE-ValueType
low complexity region 224 234 N/A INTRINSIC
low complexity region 266 282 N/A INTRINSIC
low complexity region 553 564 N/A INTRINSIC
low complexity region 725 735 N/A INTRINSIC
low complexity region 1252 1265 N/A INTRINSIC
coiled coil region 1372 1398 N/A INTRINSIC
low complexity region 1551 1562 N/A INTRINSIC
low complexity region 1725 1741 N/A INTRINSIC
low complexity region 1892 1904 N/A INTRINSIC
low complexity region 2656 2666 N/A INTRINSIC
low complexity region 2857 2872 N/A INTRINSIC
low complexity region 2901 2917 N/A INTRINSIC
low complexity region 2921 2933 N/A INTRINSIC
low complexity region 3232 3246 N/A INTRINSIC
low complexity region 3275 3335 N/A INTRINSIC
low complexity region 3441 3448 N/A INTRINSIC
low complexity region 3473 3506 N/A INTRINSIC
low complexity region 3512 3533 N/A INTRINSIC
low complexity region 3540 3554 N/A INTRINSIC
low complexity region 3794 3822 N/A INTRINSIC
HECTc 4048 4412 4.78e-11 SMART
Meta Mutation Damage Score 0.282 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 98% (104/106)
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
2610507B11Rik C T 11: 78,271,924 L871F possibly damaging Het
4933430I17Rik A T 4: 62,546,067 R374* probably null Het
5930422O12Rik A T 8: 33,429,379 R76* probably null Het
A1cf G A 19: 31,945,814 A505T probably benign Het
Abcc5 T A 16: 20,422,400 I12F probably damaging Het
Abcf2 T C 5: 24,566,564 E555G probably damaging Het
Acan A T 7: 79,100,285 E1601D probably damaging Het
Adam2 T A 14: 66,037,606 K559N probably benign Het
Akap11 A C 14: 78,510,089 D1619E possibly damaging Het
Ankrd11 T C 8: 122,895,568 D515G probably benign Het
Ankrd27 T A 7: 35,619,371 N562K probably damaging Het
Atp10b T C 11: 43,153,304 I119T probably benign Het
Atr T C 9: 95,937,566 I2202T probably benign Het
BC067074 A T 13: 113,369,143 I727F probably damaging Het
Brd4 T A 17: 32,213,540 probably benign Het
Catsperg2 C T 7: 29,706,571 C634Y possibly damaging Het
Cep192 A G 18: 67,828,482 probably benign Het
Cfap65 T A 1: 74,927,071 I366F probably damaging Het
Cnga4 G T 7: 105,407,668 R326L probably damaging Het
Cntnap5b T A 1: 100,072,153 M212K probably benign Het
Col6a6 T A 9: 105,784,116 M265L probably benign Het
Cyp26b1 A T 6: 84,574,556 F417Y probably damaging Het
Dhx15 A T 5: 52,150,746 M768K probably benign Het
Drc7 G A 8: 95,071,253 R433H possibly damaging Het
Duox2 C T 2: 122,292,304 V550M probably benign Het
Elmo2 A G 2: 165,296,890 L456P probably damaging Het
Fbxo39 T C 11: 72,317,530 I236T probably benign Het
Fezf2 A G 14: 12,343,977 C305R probably damaging Het
Fndc3b C A 3: 27,457,006 C785F probably benign Het
Gm12253 T C 11: 58,440,012 probably benign Het
Gnat2 T A 3: 108,095,562 Y95* probably null Het
Gopc T C 10: 52,350,678 K220E probably damaging Het
Hexa G A 9: 59,554,226 probably null Het
Hspa4l T C 3: 40,785,408 probably benign Het
Hspa5 T C 2: 34,774,320 S301P probably damaging Het
Ice1 A T 13: 70,604,047 S1307T possibly damaging Het
Igtp T C 11: 58,206,054 L17P probably damaging Het
Itk T C 11: 46,353,916 Y225C probably damaging Het
Kifc3 A G 8: 95,103,460 V560A probably damaging Het
Lama1 A G 17: 67,817,569 N2875D probably damaging Het
Lasp1 C A 11: 97,806,851 C32* probably null Het
Lcp2 T A 11: 34,069,854 probably benign Het
Lhx9 C T 1: 138,832,904 G236D probably benign Het
Lrrc38 A T 4: 143,350,409 I81F probably damaging Het
Ly6a C T 15: 74,995,387 V94M probably benign Het
Map3k13 A G 16: 21,914,157 E503G probably damaging Het
Mertk T C 2: 128,782,621 probably benign Het
Mkl2 T A 16: 13,412,163 I915N probably damaging Het
Msantd2 G A 9: 37,523,219 D252N possibly damaging Het
Mtmr12 T A 15: 12,257,706 L290* probably null Het
Myo3a T C 2: 22,245,598 I92T probably benign Het
Naglu T A 11: 101,074,027 N313K probably damaging Het
Nceh1 T C 3: 27,222,804 V92A possibly damaging Het
Ncf4 A G 15: 78,250,883 T47A probably damaging Het
Nrp1 T A 8: 128,460,683 F403L probably damaging Het
Nxph3 T C 11: 95,511,256 T111A possibly damaging Het
Obscn T A 11: 59,038,615 E6061V probably damaging Het
Obsl1 C A 1: 75,492,927 G1149W probably damaging Het
Olfr1162 C T 2: 88,050,412 V71I possibly damaging Het
Olfr1370 T A 13: 21,072,374 Y309F probably benign Het
Olfr1487 A G 19: 13,619,485 T65A probably benign Het
Olfr267 A T 4: 58,784,981 V247E probably damaging Het
Olfr292 A G 7: 86,694,860 T135A probably benign Het
Olfr493 A C 7: 108,346,914 D22E probably benign Het
Olfr814 T A 10: 129,874,546 L70F possibly damaging Het
Pde9a T C 17: 31,455,106 V55A probably damaging Het
Pip4k2c A T 10: 127,205,821 probably null Het
Plvap T C 8: 71,511,382 N112S probably damaging Het
Pop1 T A 15: 34,529,858 probably null Het
Ppip5k2 T C 1: 97,716,553 H1113R possibly damaging Het
Ptprk A T 10: 28,573,392 I962F probably damaging Het
Rad51ap2 T C 12: 11,457,042 S322P possibly damaging Het
Rasal1 A G 5: 120,674,605 T565A probably benign Het
Rbm15 C A 3: 107,331,155 R642S probably damaging Het
Rpsa G A 9: 120,131,003 E211K possibly damaging Het
Ryr3 A G 2: 112,686,810 S3303P probably damaging Het
Scg2 T A 1: 79,435,512 N458I possibly damaging Het
Setx A G 2: 29,179,643 T2487A probably benign Het
Slc4a5 G A 6: 83,267,567 probably benign Het
Slc8a2 T A 7: 16,140,989 D387E probably benign Het
Smarcc2 A G 10: 128,474,722 T407A probably benign Het
Snap25 A G 2: 136,777,464 D179G probably damaging Het
Socs4 T C 14: 47,289,868 S74P probably benign Het
Sp6 T A 11: 97,021,925 Y155N probably benign Het
Srrt C T 5: 137,296,127 probably benign Het
Steap1 C T 5: 5,736,431 M335I probably benign Het
Stra6 A T 9: 58,145,489 Y250F probably benign Het
Svil T C 18: 5,094,582 S1421P probably damaging Het
Tcea3 G A 4: 136,271,366 C317Y probably damaging Het
Tmco6 T C 18: 36,737,704 L117S probably damaging Het
Trp53bp1 T C 2: 121,270,237 K89E probably damaging Het
Trp63 T A 16: 25,764,302 probably benign Het
Ube2d2a A G 18: 35,800,132 Y74C probably damaging Het
Usp19 T G 9: 108,498,509 F885V probably damaging Het
Utp18 T A 11: 93,882,177 probably benign Het
Vmn2r116 T C 17: 23,401,413 I707T possibly damaging Het
Vmn2r68 T A 7: 85,233,249 probably benign Het
Vmn2r68 C G 7: 85,233,258 probably null Het
Zfp318 C T 17: 46,412,614 P1848S probably benign Het
Zfp984 G T 4: 147,755,265 N376K probably benign Het
Other mutations in Hectd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Hectd4 APN 5 121363870 missense possibly damaging 0.51
IGL00976:Hectd4 APN 5 121349106 missense probably benign 0.18
IGL01085:Hectd4 APN 5 121331701 missense probably damaging 1.00
IGL01112:Hectd4 APN 5 121306950 missense probably benign 0.01
IGL01402:Hectd4 APN 5 121339417 splice site probably benign
IGL01474:Hectd4 APN 5 121336649 missense possibly damaging 0.53
IGL01503:Hectd4 APN 5 121318651 missense probably benign 0.28
IGL01548:Hectd4 APN 5 121364660 missense possibly damaging 0.71
IGL01656:Hectd4 APN 5 121322700 missense probably damaging 0.99
IGL01756:Hectd4 APN 5 121344824 missense probably benign 0.28
IGL01819:Hectd4 APN 5 121328418 missense possibly damaging 0.85
IGL02080:Hectd4 APN 5 121366606 utr 3 prime probably benign
IGL02488:Hectd4 APN 5 121292087 missense probably benign 0.33
IGL02490:Hectd4 APN 5 121318613 missense possibly damaging 0.82
IGL02558:Hectd4 APN 5 121344785 missense probably benign 0.28
IGL02626:Hectd4 APN 5 121353881 missense possibly damaging 0.86
IGL02649:Hectd4 APN 5 121349402 missense possibly damaging 0.73
IGL02736:Hectd4 APN 5 121342719 missense possibly damaging 0.73
IGL02861:Hectd4 APN 5 121307004 missense possibly damaging 0.81
IGL02880:Hectd4 APN 5 121365053 missense possibly damaging 0.93
IGL02889:Hectd4 APN 5 121365053 missense possibly damaging 0.93
IGL02953:Hectd4 APN 5 121365053 missense possibly damaging 0.93
IGL02969:Hectd4 APN 5 121365053 missense possibly damaging 0.93
IGL03031:Hectd4 APN 5 121348794 missense possibly damaging 0.96
IGL03066:Hectd4 APN 5 121365053 missense possibly damaging 0.93
IGL03160:Hectd4 APN 5 121259879 missense probably benign
IGL03181:Hectd4 APN 5 121353958 missense possibly damaging 0.91
IGL03265:Hectd4 APN 5 121259939 splice site probably benign
IGL03375:Hectd4 APN 5 121328382 missense possibly damaging 0.72
R0018:Hectd4 UTSW 5 121254179 missense possibly damaging 0.53
R0024:Hectd4 UTSW 5 121308576 missense possibly damaging 0.92
R0030:Hectd4 UTSW 5 121262588 nonsense probably null
R0080:Hectd4 UTSW 5 121349372 missense probably benign 0.18
R0110:Hectd4 UTSW 5 121281896 missense possibly damaging 0.90
R0110:Hectd4 UTSW 5 121305673 missense possibly damaging 0.53
R0115:Hectd4 UTSW 5 121295506 splice site probably benign
R0128:Hectd4 UTSW 5 121349243 missense possibly damaging 0.86
R0131:Hectd4 UTSW 5 121333024 missense probably benign 0.44
R0131:Hectd4 UTSW 5 121333024 missense probably benign 0.44
R0132:Hectd4 UTSW 5 121333024 missense probably benign 0.44
R0244:Hectd4 UTSW 5 121329605 missense probably benign 0.33
R0329:Hectd4 UTSW 5 121259864 missense probably benign
R0410:Hectd4 UTSW 5 121286266 missense possibly damaging 0.86
R0422:Hectd4 UTSW 5 121343082 splice site probably null
R0442:Hectd4 UTSW 5 121323982 missense possibly damaging 0.66
R0449:Hectd4 UTSW 5 121364590 synonymous probably null
R0469:Hectd4 UTSW 5 121281896 missense possibly damaging 0.90
R0469:Hectd4 UTSW 5 121305673 missense possibly damaging 0.53
R0481:Hectd4 UTSW 5 121295506 splice site probably benign
R0510:Hectd4 UTSW 5 121281896 missense possibly damaging 0.90
R0510:Hectd4 UTSW 5 121305673 missense possibly damaging 0.53
R0520:Hectd4 UTSW 5 121331707 missense possibly damaging 0.53
R0534:Hectd4 UTSW 5 121348476 missense possibly damaging 0.96
R0603:Hectd4 UTSW 5 121304337 missense possibly damaging 0.46
R0617:Hectd4 UTSW 5 121343232 splice site probably benign
R0622:Hectd4 UTSW 5 121348625 missense possibly damaging 0.53
R0626:Hectd4 UTSW 5 121277824 missense probably benign 0.18
R0708:Hectd4 UTSW 5 121286463 critical splice donor site probably null
R0710:Hectd4 UTSW 5 121336628 missense probably benign 0.08
R0763:Hectd4 UTSW 5 121307033 unclassified probably benign
R0764:Hectd4 UTSW 5 121286769 missense possibly damaging 0.46
R1123:Hectd4 UTSW 5 121286736 missense probably damaging 0.96
R1129:Hectd4 UTSW 5 121310599 missense possibly damaging 0.66
R1204:Hectd4 UTSW 5 121350485 missense possibly damaging 0.85
R1237:Hectd4 UTSW 5 121321507 missense possibly damaging 0.90
R1257:Hectd4 UTSW 5 121318624 nonsense probably null
R1391:Hectd4 UTSW 5 121353695 missense possibly damaging 0.96
R1395:Hectd4 UTSW 5 121328513 critical splice donor site probably null
R1468:Hectd4 UTSW 5 121349172 missense possibly damaging 0.65
R1468:Hectd4 UTSW 5 121349172 missense possibly damaging 0.65
R1545:Hectd4 UTSW 5 121323956 missense possibly damaging 0.87
R1553:Hectd4 UTSW 5 121349259 missense probably benign 0.00
R1572:Hectd4 UTSW 5 121301878 missense possibly damaging 0.85
R1662:Hectd4 UTSW 5 121317245 missense probably benign 0.01
R1705:Hectd4 UTSW 5 121298104 missense probably benign
R1715:Hectd4 UTSW 5 121344818 missense possibly damaging 0.85
R1728:Hectd4 UTSW 5 121301839 missense possibly damaging 0.51
R1736:Hectd4 UTSW 5 121349530 missense possibly damaging 0.53
R1768:Hectd4 UTSW 5 121358303 missense possibly damaging 0.70
R1775:Hectd4 UTSW 5 121291191 splice site probably benign
R1784:Hectd4 UTSW 5 121301839 missense possibly damaging 0.51
R1843:Hectd4 UTSW 5 121297180 missense possibly damaging 0.53
R1914:Hectd4 UTSW 5 121322294 missense probably benign 0.08
R1915:Hectd4 UTSW 5 121322294 missense probably benign 0.08
R2024:Hectd4 UTSW 5 121281918 missense possibly damaging 0.86
R2103:Hectd4 UTSW 5 121355629 missense probably benign 0.04
R2108:Hectd4 UTSW 5 121333424 missense possibly damaging 0.72
R2124:Hectd4 UTSW 5 121318639 missense probably damaging 0.97
R2150:Hectd4 UTSW 5 121253858 splice site probably benign
R2192:Hectd4 UTSW 5 121315143 missense possibly damaging 0.46
R2301:Hectd4 UTSW 5 121353537 missense probably benign 0.18
R2324:Hectd4 UTSW 5 121315437 missense probably damaging 1.00
R2331:Hectd4 UTSW 5 121320026 missense probably benign 0.05
R2504:Hectd4 UTSW 5 121220620 missense unknown
R2504:Hectd4 UTSW 5 121263967 missense possibly damaging 0.73
R2904:Hectd4 UTSW 5 121292724 splice site probably benign
R3843:Hectd4 UTSW 5 121259873 missense possibly damaging 0.72
R3934:Hectd4 UTSW 5 121320101 critical splice donor site probably null
R3944:Hectd4 UTSW 5 121303525 splice site probably benign
R4133:Hectd4 UTSW 5 121277834 critical splice donor site probably null
R4271:Hectd4 UTSW 5 121220504 small deletion probably benign
R4413:Hectd4 UTSW 5 121350481 missense possibly damaging 0.53
R4456:Hectd4 UTSW 5 121308271 missense possibly damaging 0.65
R4489:Hectd4 UTSW 5 121286257 missense possibly damaging 0.73
R4539:Hectd4 UTSW 5 121314907 nonsense probably null
R4564:Hectd4 UTSW 5 121350431 missense probably benign 0.33
R4582:Hectd4 UTSW 5 121286419 missense possibly damaging 0.53
R4629:Hectd4 UTSW 5 121297203 missense probably benign 0.01
R4633:Hectd4 UTSW 5 121349216 missense probably benign 0.33
R4643:Hectd4 UTSW 5 121349055 missense possibly damaging 0.53
R4679:Hectd4 UTSW 5 121325251 missense possibly damaging 0.72
R4681:Hectd4 UTSW 5 121303615 missense possibly damaging 0.86
R4734:Hectd4 UTSW 5 121341977 missense possibly damaging 0.53
R4739:Hectd4 UTSW 5 121348442 missense probably benign
R4781:Hectd4 UTSW 5 121306107 critical splice donor site probably null
R4860:Hectd4 UTSW 5 121305818 missense probably benign 0.04
R4860:Hectd4 UTSW 5 121305818 missense probably benign 0.04
R4869:Hectd4 UTSW 5 121322672 missense possibly damaging 0.46
R4909:Hectd4 UTSW 5 121263891 missense probably benign 0.18
R4922:Hectd4 UTSW 5 121359315 missense possibly damaging 0.86
R4925:Hectd4 UTSW 5 121322690 missense possibly damaging 0.83
R5004:Hectd4 UTSW 5 121328199 unclassified probably null
R5004:Hectd4 UTSW 5 121329565 missense possibly damaging 0.93
R5129:Hectd4 UTSW 5 121343510 missense possibly damaging 0.87
R5217:Hectd4 UTSW 5 121353551 missense possibly damaging 0.53
R5267:Hectd4 UTSW 5 121344824 missense probably benign 0.28
R5344:Hectd4 UTSW 5 121343676 missense probably benign 0.28
R5345:Hectd4 UTSW 5 121263974 missense possibly damaging 0.85
R5347:Hectd4 UTSW 5 121304448 missense probably benign 0.33
R5360:Hectd4 UTSW 5 121315401 missense possibly damaging 0.90
R5363:Hectd4 UTSW 5 121310603 missense probably benign 0.04
R5445:Hectd4 UTSW 5 121266274 missense probably benign 0.00
R5479:Hectd4 UTSW 5 121306948 missense probably benign
R5507:Hectd4 UTSW 5 121281101 missense unknown
R5552:Hectd4 UTSW 5 121342851 missense possibly damaging 0.96
R5691:Hectd4 UTSW 5 121348815 missense possibly damaging 0.85
R5745:Hectd4 UTSW 5 121353502 missense possibly damaging 0.96
R5757:Hectd4 UTSW 5 121348619 missense possibly damaging 0.72
R5845:Hectd4 UTSW 5 121307524 critical splice donor site probably null
R5869:Hectd4 UTSW 5 121343225 critical splice donor site probably null
R5913:Hectd4 UTSW 5 121323974 missense possibly damaging 0.83
R5920:Hectd4 UTSW 5 121308271 missense possibly damaging 0.65
R5943:Hectd4 UTSW 5 121322294 missense probably benign 0.01
R6219:Hectd4 UTSW 5 121308878 missense possibly damaging 0.92
R6250:Hectd4 UTSW 5 121339498 missense possibly damaging 0.85
R6301:Hectd4 UTSW 5 121254220 missense possibly damaging 0.91
R6428:Hectd4 UTSW 5 121350445 missense possibly damaging 0.53
R6446:Hectd4 UTSW 5 121334375 missense possibly damaging 0.86
R6453:Hectd4 UTSW 5 121350592 missense probably damaging 1.00
R6513:Hectd4 UTSW 5 121356196 splice site probably null
R6540:Hectd4 UTSW 5 121303571 missense probably benign 0.33
R6706:Hectd4 UTSW 5 121320084 missense possibly damaging 0.92
R6720:Hectd4 UTSW 5 121307381 nonsense probably null
R6736:Hectd4 UTSW 5 121277725 missense possibly damaging 0.86
R6776:Hectd4 UTSW 5 121353511 missense possibly damaging 0.85
R7033:Hectd4 UTSW 5 121364568 missense possibly damaging 0.86
R7038:Hectd4 UTSW 5 121299597 missense possibly damaging 0.90
X0026:Hectd4 UTSW 5 121349637 missense probably benign 0.04
X0027:Hectd4 UTSW 5 121321404 missense probably benign 0.27
Z1088:Hectd4 UTSW 5 121295503 splice site probably null
Predicted Primers PCR Primer
(F):5'- TGGAATACCGCCTGAATGCCTTG -3'
(R):5'- TGTCATTACAGCAGAGCAGCACAC -3'

Sequencing Primer
(F):5'- TGGACTATGGAATGCCCAGC -3'
(R):5'- GAGGCTGTGACTTTCAACAC -3'
Posted On2013-05-23