Incidental Mutation 'R4880:Myh7'
ID375246
Institutional Source Beutler Lab
Gene Symbol Myh7
Ensembl Gene ENSMUSG00000053093
Gene Namemyosin, heavy polypeptide 7, cardiac muscle, beta
SynonymsMyhcb, Myhc-b, MyHC-I, B-MHC, MYH-beta/slow, beta-MHC
MMRRC Submission 042489-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.812) question?
Stock #R4880 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location54970684-54994626 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 54978588 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 1323 (V1323F)
Ref Sequence ENSEMBL: ENSMUSP00000126840 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085949] [ENSMUST00000102803] [ENSMUST00000168485]
Predicted Effect probably benign
Transcript: ENSMUST00000085949
Predicted Effect probably benign
Transcript: ENSMUST00000102803
AA Change: V1323F

PolyPhen 2 Score 0.179 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000099867
Gene: ENSMUSG00000053093
AA Change: V1323F

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:Myosin_N 34 73 3.8e-16 PFAM
MYSc 79 779 N/A SMART
IQ 780 802 2.5e-2 SMART
Pfam:Myosin_tail_1 843 1924 5.6e-168 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104735
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149852
Predicted Effect probably benign
Transcript: ENSMUST00000168485
AA Change: V1323F

PolyPhen 2 Score 0.179 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000126840
Gene: ENSMUSG00000053093
AA Change: V1323F

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:Myosin_N 34 75 1.6e-17 PFAM
MYSc 79 779 N/A SMART
IQ 780 802 2.5e-2 SMART
PDB:2FXO|D 838 963 6e-53 PDB
Pfam:Myosin_tail_1 1068 1926 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181782
SMART Domains Protein: ENSMUSP00000137786
Gene: ENSMUSG00000097652

DomainStartEndE-ValueType
low complexity region 22 34 N/A INTRINSIC
low complexity region 44 94 N/A INTRINSIC
low complexity region 139 151 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228715
Meta Mutation Damage Score 0.262 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency 98% (89/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Muscle myosin is a hexameric protein containing 2 heavy chain subunits, 2 alkali light chain subunits, and 2 regulatory light chain subunits. This gene encodes the beta (or slow) heavy chain subunit of cardiac myosin. It is expressed predominantly in normal human ventricle. It is also expressed in skeletal muscle tissues rich in slow-twitch type I muscle fibers. Changes in the relative abundance of this protein and the alpha (or fast) heavy subunit of cardiac myosin correlate with the contractile velocity of cardiac muscle. Its expression is also altered during thyroid hormone depletion and hemodynamic overloading. Mutations in this gene are associated with familial hypertrophic cardiomyopathy, myosin storage myopathy, dilated cardiomyopathy, and Laing early-onset distal myopathy. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik A G 9: 92,354,612 E108G probably damaging Het
2610021A01Rik T C 7: 41,627,105 I744T possibly damaging Het
4931409K22Rik T C 5: 24,549,752 D340G probably benign Het
Adgrb1 T A 15: 74,587,022 F1324L possibly damaging Het
Adm A G 7: 110,629,119 H230R probably benign Het
Ank2 A T 3: 127,046,826 probably null Het
Arih1 A T 9: 59,436,885 F156L possibly damaging Het
Atf6b A G 17: 34,654,555 H660R probably damaging Het
Bcl9l C A 9: 44,508,710 Q1101K probably benign Het
Ccdc174 G A 6: 91,899,591 probably benign Het
Ccdc65 A C 15: 98,722,657 probably null Het
Cela2a T C 4: 141,822,287 N59S probably benign Het
Cfap157 A T 2: 32,778,249 V393E probably damaging Het
Chd1 T C 17: 17,374,654 F17S probably damaging Het
Cpne3 T C 4: 19,540,827 I183V probably benign Het
Cyp2d11 C A 15: 82,392,105 V122L probably benign Het
Dcaf8 C A 1: 172,187,489 probably benign Het
Dchs1 T A 7: 105,755,730 D2535V probably benign Het
Eif4a2 G T 16: 23,108,900 probably benign Het
Fzd4 T A 7: 89,407,901 D385E probably benign Het
Galnt13 C A 2: 55,060,572 Q422K probably damaging Het
Gm9745 A T 13: 8,940,666 probably null Het
Gnptab C T 10: 88,432,551 Q507* probably null Het
Hoxa7 A G 6: 52,217,034 probably benign Het
Htra1 T A 7: 130,962,083 V228D probably damaging Het
Ifi203 T A 1: 173,929,150 probably benign Het
Irs1 TGGGGTGGACATCGAACTGAAGGAG TG 1: 82,287,732 probably null Het
Itga2b G T 11: 102,457,722 probably benign Het
Itgb1 G T 8: 128,716,150 R272L probably damaging Het
Kif9 A G 9: 110,501,635 E343G probably damaging Het
Klhl5 T C 5: 65,158,901 V97A probably damaging Het
Lama5 C A 2: 180,177,068 probably benign Het
Lamb2 A G 9: 108,484,027 probably null Het
Lrp1b T A 2: 41,770,919 Y59F probably benign Het
Mmrn1 A G 6: 60,976,439 E568G probably benign Het
Mreg A G 1: 72,162,336 Y166H probably damaging Het
Nr1i3 T A 1: 171,216,382 I91K probably damaging Het
Nsfl1c T A 2: 151,506,310 D206E probably damaging Het
Olfr1294 A T 2: 111,537,353 L312* probably null Het
Olfr181 A C 16: 58,926,100 L157W probably damaging Het
Olfr273 A T 4: 52,856,411 M34K probably damaging Het
Olfr318 G A 11: 58,720,281 L256F probably benign Het
Olfr739 T C 14: 50,425,301 Y261H possibly damaging Het
Olfr921 T A 9: 38,775,547 C97* probably null Het
Pcdhb7 C T 18: 37,342,231 T140I probably benign Het
Pcdhgb5 T G 18: 37,732,588 S479A probably benign Het
Pcsk5 T A 19: 17,447,690 Y1583F probably damaging Het
Pias1 T C 9: 62,912,798 R296G probably benign Het
Polr1e T A 4: 45,022,280 C100S probably damaging Het
Rpap1 C A 2: 119,783,865 R17L probably damaging Het
Rtn1 C T 12: 72,217,458 V192I possibly damaging Het
Ryr2 G A 13: 11,752,218 P1262L probably damaging Het
Slc4a7 G T 14: 14,757,342 D396Y probably damaging Het
Slc5a8 T C 10: 88,892,024 Y118H probably damaging Het
Slc7a6os T A 8: 106,210,615 Q71L probably benign Het
Sphkap A G 1: 83,288,817 V127A probably damaging Het
Srpk1 A G 17: 28,591,225 S580P probably damaging Het
Syne2 A G 12: 75,979,819 I3474V probably damaging Het
Tchh A G 3: 93,443,823 D190G possibly damaging Het
Tenm4 T A 7: 96,905,818 probably null Het
Tex14 T A 11: 87,486,295 I155N possibly damaging Het
Tm7sf3 A T 6: 146,609,860 V377E possibly damaging Het
Tnfsf9 T A 17: 57,105,433 M1K probably null Het
Tns2 C T 15: 102,112,039 T780I probably damaging Het
Trdn T A 10: 33,471,579 D639E probably benign Het
Trmt10a A G 3: 138,152,211 E173G possibly damaging Het
Ttn G A 2: 76,818,775 P10984S possibly damaging Het
Tubb6 C T 18: 67,401,316 T95M possibly damaging Het
Uroc1 G T 6: 90,357,537 R577L probably damaging Het
Vmn2r86 T A 10: 130,453,615 D137V probably benign Het
Xkr7 T C 2: 153,054,953 Y576H probably damaging Het
Zfp410 A G 12: 84,337,675 N355D probably damaging Het
Zfp59 C A 7: 27,844,317 D22E probably damaging Het
Zfp64 C T 2: 168,894,377 R460H probably damaging Het
Zfp655 T C 5: 145,244,358 V342A probably damaging Het
Zfp990 G A 4: 145,537,920 G496E probably benign Het
Other mutations in Myh7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Myh7 APN 14 54987388 missense probably damaging 1.00
IGL01025:Myh7 APN 14 54979537 missense probably damaging 1.00
IGL01092:Myh7 APN 14 54971632 missense possibly damaging 0.91
IGL01384:Myh7 APN 14 54971459 missense probably damaging 1.00
IGL01457:Myh7 APN 14 54988879 missense possibly damaging 0.66
IGL01671:Myh7 APN 14 54972924 missense probably damaging 1.00
IGL01923:Myh7 APN 14 54985459 critical splice donor site probably null
IGL02183:Myh7 APN 14 54974731 missense probably benign
IGL02379:Myh7 APN 14 54979468 missense probably damaging 1.00
IGL02884:Myh7 APN 14 54992819 missense probably benign 0.26
IGL02898:Myh7 APN 14 54983740 missense probably damaging 1.00
IGL03027:Myh7 APN 14 54983550 missense probably damaging 1.00
IGL03061:Myh7 APN 14 54991204 unclassified probably benign
IGL03145:Myh7 APN 14 54983345 missense probably damaging 1.00
IGL03250:Myh7 APN 14 54992247 missense probably damaging 1.00
IGL03394:Myh7 APN 14 54975361 missense probably damaging 1.00
R0019:Myh7 UTSW 14 54983734 missense possibly damaging 0.91
R0030:Myh7 UTSW 14 54991970 missense probably benign 0.00
R0183:Myh7 UTSW 14 54978876 missense probably benign 0.02
R0230:Myh7 UTSW 14 54973933 missense probably benign 0.03
R0295:Myh7 UTSW 14 54984821 splice site probably benign
R0423:Myh7 UTSW 14 54979189 missense probably benign 0.06
R0537:Myh7 UTSW 14 54990799 missense possibly damaging 0.81
R0541:Myh7 UTSW 14 54974701 missense probably benign
R0581:Myh7 UTSW 14 54985496 missense probably benign 0.02
R0786:Myh7 UTSW 14 54992873 start codon destroyed probably null
R0866:Myh7 UTSW 14 54973139 missense probably benign
R1068:Myh7 UTSW 14 54987319 missense possibly damaging 0.93
R1075:Myh7 UTSW 14 54987403 missense probably benign
R1124:Myh7 UTSW 14 54973870 missense possibly damaging 0.78
R1140:Myh7 UTSW 14 54972882 missense probably damaging 1.00
R1260:Myh7 UTSW 14 54988451 missense probably benign 0.00
R1653:Myh7 UTSW 14 54990789 missense probably benign 0.00
R1677:Myh7 UTSW 14 54987516 missense probably benign 0.17
R1760:Myh7 UTSW 14 54972713 missense probably damaging 1.00
R1838:Myh7 UTSW 14 54973180 missense possibly damaging 0.91
R1839:Myh7 UTSW 14 54973180 missense possibly damaging 0.91
R2483:Myh7 UTSW 14 54973381 missense probably damaging 0.99
R2566:Myh7 UTSW 14 54983242 missense probably damaging 1.00
R3623:Myh7 UTSW 14 54973381 missense probably damaging 0.99
R3916:Myh7 UTSW 14 54974046 missense probably damaging 0.97
R4236:Myh7 UTSW 14 54991118 missense probably benign 0.34
R4471:Myh7 UTSW 14 54991854 nonsense probably null
R4700:Myh7 UTSW 14 54988321 missense possibly damaging 0.85
R4805:Myh7 UTSW 14 54985133 missense probably benign 0.27
R4975:Myh7 UTSW 14 54971671 missense probably damaging 1.00
R4982:Myh7 UTSW 14 54972767 missense probably damaging 0.98
R5004:Myh7 UTSW 14 54971683 missense probably damaging 0.99
R5107:Myh7 UTSW 14 54986424 intron probably benign
R5124:Myh7 UTSW 14 54985742 nonsense probably null
R5256:Myh7 UTSW 14 54979508 missense probably damaging 1.00
R5335:Myh7 UTSW 14 54986563 intron probably benign
R5581:Myh7 UTSW 14 54978954 missense probably benign 0.00
R5861:Myh7 UTSW 14 54988890 missense possibly damaging 0.89
R5957:Myh7 UTSW 14 54989078 missense probably damaging 1.00
R6027:Myh7 UTSW 14 54970802 missense probably benign 0.01
R6184:Myh7 UTSW 14 54988858 missense probably damaging 1.00
R6232:Myh7 UTSW 14 54989296 missense probably benign 0.00
R6268:Myh7 UTSW 14 54989284 missense probably benign 0.00
R6274:Myh7 UTSW 14 54979486 missense probably damaging 0.97
R6345:Myh7 UTSW 14 54983692 missense probably damaging 1.00
R6383:Myh7 UTSW 14 54988894 missense probably benign 0.00
R6641:Myh7 UTSW 14 54982280 missense probably benign 0.37
R6755:Myh7 UTSW 14 54992313 missense possibly damaging 0.71
R6952:Myh7 UTSW 14 54991740 missense probably damaging 1.00
R7025:Myh7 UTSW 14 54974644 nonsense probably null
R7201:Myh7 UTSW 14 54990945 missense possibly damaging 0.58
R7257:Myh7 UTSW 14 54972490 intron probably null
R7296:Myh7 UTSW 14 54990025 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AAAGGGCCTCTCTCAGCCTG -3'
(R):5'- CATGCTCCTCATATGCCCACAG -3'

Sequencing Primer
(F):5'- TCTCTCAGCCTGGGGAAC -3'
(R):5'- ACAGCCTCTCCAGAGAAGGG -3'
Posted On2016-03-17