Incidental Mutation 'R4881:Zfp661'
ID375265
Institutional Source Beutler Lab
Gene Symbol Zfp661
Ensembl Gene ENSMUSG00000034800
Gene Namezinc finger protein 661
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.210) question?
Stock #R4881 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location127574662-127587094 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 127578644 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 78 (H78Q)
Ref Sequence ENSEMBL: ENSMUSP00000132820 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077422] [ENSMUST00000110366] [ENSMUST00000110368] [ENSMUST00000164551]
Predicted Effect probably benign
Transcript: ENSMUST00000077422
AA Change: H78Q

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000076637
Gene: ENSMUSG00000034800
AA Change: H78Q

DomainStartEndE-ValueType
KRAB 14 74 1.33e-28 SMART
ZnF_C2H2 169 191 1.12e-3 SMART
ZnF_C2H2 197 219 6.42e-4 SMART
ZnF_C2H2 225 247 7.37e-4 SMART
ZnF_C2H2 253 275 9.22e-5 SMART
ZnF_C2H2 281 303 9.73e-4 SMART
ZnF_C2H2 309 331 1.04e-3 SMART
ZnF_C2H2 337 359 5.67e-5 SMART
ZnF_C2H2 365 387 5.99e-4 SMART
ZnF_C2H2 393 413 4.94e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110366
AA Change: H78Q

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000105995
Gene: ENSMUSG00000034800
AA Change: H78Q

DomainStartEndE-ValueType
KRAB 14 74 1.33e-28 SMART
ZnF_C2H2 169 191 1.12e-3 SMART
ZnF_C2H2 197 219 6.42e-4 SMART
ZnF_C2H2 225 247 7.37e-4 SMART
ZnF_C2H2 253 275 9.22e-5 SMART
ZnF_C2H2 281 303 9.73e-4 SMART
ZnF_C2H2 309 331 1.04e-3 SMART
ZnF_C2H2 337 359 5.67e-5 SMART
ZnF_C2H2 365 387 5.99e-4 SMART
ZnF_C2H2 393 413 4.94e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110368
AA Change: H78Q

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000105997
Gene: ENSMUSG00000034800
AA Change: H78Q

DomainStartEndE-ValueType
KRAB 14 74 1.33e-28 SMART
ZnF_C2H2 169 191 1.12e-3 SMART
ZnF_C2H2 197 219 6.42e-4 SMART
ZnF_C2H2 225 247 7.37e-4 SMART
ZnF_C2H2 253 275 9.22e-5 SMART
ZnF_C2H2 281 303 9.73e-4 SMART
ZnF_C2H2 309 331 1.04e-3 SMART
ZnF_C2H2 337 359 5.67e-5 SMART
ZnF_C2H2 365 387 5.99e-4 SMART
ZnF_C2H2 393 413 4.94e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164551
AA Change: H78Q

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000132820
Gene: ENSMUSG00000034800
AA Change: H78Q

DomainStartEndE-ValueType
KRAB 14 74 1.33e-28 SMART
ZnF_C2H2 169 191 1.12e-3 SMART
ZnF_C2H2 197 219 6.42e-4 SMART
ZnF_C2H2 225 247 7.37e-4 SMART
ZnF_C2H2 253 275 9.22e-5 SMART
ZnF_C2H2 281 303 9.73e-4 SMART
ZnF_C2H2 309 331 1.04e-3 SMART
ZnF_C2H2 337 359 5.67e-5 SMART
ZnF_C2H2 365 387 5.99e-4 SMART
ZnF_C2H2 393 413 4.94e0 SMART
Meta Mutation Damage Score 0.102 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the C2H2-type zinc-finger protein family. The exact function of this gene is not known, however, zinc-finger proteins are known to interact with DNA and function as transcription regulators. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2014]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T C 7: 120,278,249 L1040P possibly damaging Het
Acot11 C A 4: 106,755,305 probably null Het
Aldoart2 C A 12: 55,566,114 Q275K probably damaging Het
Auts2 T C 5: 131,472,450 T42A probably damaging Het
Bora C T 14: 99,061,567 L187F probably damaging Het
Cbln4 A G 2: 172,042,139 S54P possibly damaging Het
Celsr3 T A 9: 108,843,941 L2661Q probably damaging Het
Cfap65 T C 1: 74,907,613 T1313A probably damaging Het
Dbndd2 C A 2: 164,490,305 probably benign Het
Dennd4a A G 9: 64,838,844 D4G possibly damaging Het
Dmxl1 T A 18: 49,957,281 probably benign Het
Dnah7b T C 1: 46,201,318 C1532R probably damaging Het
Erbb3 A T 10: 128,576,947 H591Q probably benign Het
Exosc4 T C 15: 76,329,570 L198P probably damaging Het
F2r A T 13: 95,618,329 C16S possibly damaging Het
Fam129b C A 2: 32,922,578 Y446* probably null Het
Gtf2h4 A T 17: 35,670,233 I234N possibly damaging Het
Ift27 A T 15: 78,165,248 V84D probably damaging Het
Ints10 C T 8: 68,810,604 A389V probably benign Het
Irs1 TGGGGTGGACATCGAACTGAAGGAG TG 1: 82,287,732 probably null Het
Klrc2 T A 6: 129,660,508 T17S possibly damaging Het
Matr3 T A 18: 35,572,375 S118T probably damaging Het
Mfsd6l C T 11: 68,557,922 A533V probably benign Het
Msh3 A G 13: 92,266,041 probably benign Het
Myo5c A G 9: 75,284,152 M1103V probably benign Het
Olfr1336 A T 7: 6,460,754 M82L probably benign Het
Olfr1391 T A 11: 49,328,297 D295E probably benign Het
Olfr513 T C 7: 108,755,405 L183P probably damaging Het
Osbpl3 A T 6: 50,352,784 D88E possibly damaging Het
Pou1f1 C T 16: 65,531,842 T149I probably damaging Het
Ppp1r12b G T 1: 134,955,733 A17E probably benign Het
Pstpip2 T A 18: 77,874,332 Y267* probably null Het
Rcor1 A G 12: 111,097,552 D95G probably damaging Het
Rttn T C 18: 89,101,685 L1748P probably damaging Het
Slco2a1 A G 9: 103,085,832 K629E possibly damaging Het
Smarcc1 A G 9: 110,135,628 probably benign Het
Son A G 16: 91,675,509 K360E probably benign Het
Stab1 A T 14: 31,143,672 M1753K probably benign Het
Syne2 A G 12: 75,979,819 I3474V probably damaging Het
Tmem63c A T 12: 87,086,418 T736S possibly damaging Het
Tmpo G A 10: 91,162,641 P428L possibly damaging Het
Tmprss11a G T 5: 86,422,573 Q176K probably damaging Het
Trappc4 A G 9: 44,404,025 S219P probably damaging Het
Vmn2r117 G T 17: 23,477,885 P183T probably damaging Het
Vmn2r54 C T 7: 12,629,671 V432I probably benign Het
Vtcn1 G A 3: 100,892,593 G257R probably benign Het
Yipf1 T A 4: 107,345,091 M217K possibly damaging Het
Zfc3h1 T C 10: 115,400,742 S374P probably benign Het
Zfp407 T C 18: 84,559,703 H1095R probably benign Het
Zfp957 T C 14: 79,213,409 T317A unknown Het
Zfyve9 T A 4: 108,727,491 probably null Het
Other mutations in Zfp661
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0139:Zfp661 UTSW 2 127578612 missense possibly damaging 0.93
R0217:Zfp661 UTSW 2 127577291 missense probably damaging 0.98
R0402:Zfp661 UTSW 2 127577720 nonsense probably null
R4429:Zfp661 UTSW 2 127578708 missense probably damaging 0.96
R4689:Zfp661 UTSW 2 127577548 missense probably damaging 1.00
R5192:Zfp661 UTSW 2 127577062 missense possibly damaging 0.83
R5996:Zfp661 UTSW 2 127577048 missense probably damaging 0.97
R6074:Zfp661 UTSW 2 127577873 missense probably benign 0.00
R7062:Zfp661 UTSW 2 127577120 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATTTGAGCAAAGGTGGCTCC -3'
(R):5'- AAGAGCTCCAGTCCTGACCTTC -3'

Sequencing Primer
(F):5'- AGGTGGCTCCTAACACTCC -3'
(R):5'- GTCAGTTCTCTGCATTTCTAGAAGAG -3'
Posted On2016-03-17