Incidental Mutation 'R4881:Myo5c'
ID375283
Institutional Source Beutler Lab
Gene Symbol Myo5c
Ensembl Gene ENSMUSG00000033590
Gene Namemyosin VC
Synonyms9130003O20Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R4881 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location75232020-75305451 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75284152 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 1103 (M1103V)
Ref Sequence ENSEMBL: ENSMUSP00000042229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036555] [ENSMUST00000216788]
Predicted Effect probably benign
Transcript: ENSMUST00000036555
AA Change: M1103V

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000042229
Gene: ENSMUSG00000033590
AA Change: M1103V

DomainStartEndE-ValueType
MYSc 61 754 N/A SMART
IQ 755 777 1.11e-3 SMART
IQ 778 800 1.39e0 SMART
IQ 806 828 8.98e-4 SMART
IQ 829 851 4.19e-4 SMART
IQ 854 876 2.54e-3 SMART
coiled coil region 1160 1185 N/A INTRINSIC
coiled coil region 1207 1245 N/A INTRINSIC
DIL 1574 1679 5.54e-45 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215620
Predicted Effect probably benign
Transcript: ENSMUST00000216788
Meta Mutation Damage Score 0.072 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T C 7: 120,278,249 L1040P possibly damaging Het
Acot11 C A 4: 106,755,305 probably null Het
Aldoart2 C A 12: 55,566,114 Q275K probably damaging Het
Auts2 T C 5: 131,472,450 T42A probably damaging Het
Bora C T 14: 99,061,567 L187F probably damaging Het
Cbln4 A G 2: 172,042,139 S54P possibly damaging Het
Celsr3 T A 9: 108,843,941 L2661Q probably damaging Het
Cfap65 T C 1: 74,907,613 T1313A probably damaging Het
Dbndd2 C A 2: 164,490,305 probably benign Het
Dennd4a A G 9: 64,838,844 D4G possibly damaging Het
Dmxl1 T A 18: 49,957,281 probably benign Het
Dnah7b T C 1: 46,201,318 C1532R probably damaging Het
Erbb3 A T 10: 128,576,947 H591Q probably benign Het
Exosc4 T C 15: 76,329,570 L198P probably damaging Het
F2r A T 13: 95,618,329 C16S possibly damaging Het
Fam129b C A 2: 32,922,578 Y446* probably null Het
Gtf2h4 A T 17: 35,670,233 I234N possibly damaging Het
Ift27 A T 15: 78,165,248 V84D probably damaging Het
Ints10 C T 8: 68,810,604 A389V probably benign Het
Irs1 TGGGGTGGACATCGAACTGAAGGAG TG 1: 82,287,732 probably null Het
Klrc2 T A 6: 129,660,508 T17S possibly damaging Het
Matr3 T A 18: 35,572,375 S118T probably damaging Het
Mfsd6l C T 11: 68,557,922 A533V probably benign Het
Msh3 A G 13: 92,266,041 probably benign Het
Olfr1336 A T 7: 6,460,754 M82L probably benign Het
Olfr1391 T A 11: 49,328,297 D295E probably benign Het
Olfr513 T C 7: 108,755,405 L183P probably damaging Het
Osbpl3 A T 6: 50,352,784 D88E possibly damaging Het
Pou1f1 C T 16: 65,531,842 T149I probably damaging Het
Ppp1r12b G T 1: 134,955,733 A17E probably benign Het
Pstpip2 T A 18: 77,874,332 Y267* probably null Het
Rcor1 A G 12: 111,097,552 D95G probably damaging Het
Rttn T C 18: 89,101,685 L1748P probably damaging Het
Slco2a1 A G 9: 103,085,832 K629E possibly damaging Het
Smarcc1 A G 9: 110,135,628 probably benign Het
Son A G 16: 91,675,509 K360E probably benign Het
Stab1 A T 14: 31,143,672 M1753K probably benign Het
Syne2 A G 12: 75,979,819 I3474V probably damaging Het
Tmem63c A T 12: 87,086,418 T736S possibly damaging Het
Tmpo G A 10: 91,162,641 P428L possibly damaging Het
Tmprss11a G T 5: 86,422,573 Q176K probably damaging Het
Trappc4 A G 9: 44,404,025 S219P probably damaging Het
Vmn2r117 G T 17: 23,477,885 P183T probably damaging Het
Vmn2r54 C T 7: 12,629,671 V432I probably benign Het
Vtcn1 G A 3: 100,892,593 G257R probably benign Het
Yipf1 T A 4: 107,345,091 M217K possibly damaging Het
Zfc3h1 T C 10: 115,400,742 S374P probably benign Het
Zfp407 T C 18: 84,559,703 H1095R probably benign Het
Zfp661 A T 2: 127,578,644 H78Q probably benign Het
Zfp957 T C 14: 79,213,409 T317A unknown Het
Zfyve9 T A 4: 108,727,491 probably null Het
Other mutations in Myo5c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Myo5c APN 9 75242880 splice site probably benign
IGL00848:Myo5c APN 9 75289181 missense probably benign
IGL01503:Myo5c APN 9 75263042 missense probably damaging 1.00
IGL01735:Myo5c APN 9 75301438 missense probably damaging 1.00
IGL01866:Myo5c APN 9 75269582 missense probably benign 0.00
IGL01956:Myo5c APN 9 75242876 splice site probably null
IGL02127:Myo5c APN 9 75300902 missense probably damaging 1.00
IGL02268:Myo5c APN 9 75246237 missense probably damaging 1.00
IGL02272:Myo5c APN 9 75266160 missense possibly damaging 0.73
IGL03052:Myo5c APN 9 75252516 splice site probably benign
IGL03179:Myo5c APN 9 75255866 missense possibly damaging 0.65
IGL03224:Myo5c APN 9 75278243 missense probably benign 0.01
PIT4142001:Myo5c UTSW 9 75283948 missense probably benign 0.00
R0126:Myo5c UTSW 9 75269525 missense probably benign 0.05
R0266:Myo5c UTSW 9 75284216 splice site probably benign
R0345:Myo5c UTSW 9 75297419 missense probably damaging 1.00
R0387:Myo5c UTSW 9 75285021 splice site probably benign
R0602:Myo5c UTSW 9 75266196 splice site probably null
R0675:Myo5c UTSW 9 75278289 missense probably benign
R0798:Myo5c UTSW 9 75257984 missense probably damaging 1.00
R0981:Myo5c UTSW 9 75271591 missense probably damaging 1.00
R1051:Myo5c UTSW 9 75290883 missense probably benign 0.00
R1072:Myo5c UTSW 9 75292208 missense probably damaging 1.00
R1144:Myo5c UTSW 9 75286448 missense probably damaging 1.00
R1454:Myo5c UTSW 9 75263066 missense possibly damaging 0.94
R1476:Myo5c UTSW 9 75275939 missense probably damaging 1.00
R1484:Myo5c UTSW 9 75300810 missense probably damaging 1.00
R1586:Myo5c UTSW 9 75267031 missense probably damaging 0.99
R1616:Myo5c UTSW 9 75296017 missense probably damaging 1.00
R1635:Myo5c UTSW 9 75277075 missense probably benign 0.09
R1800:Myo5c UTSW 9 75246164 missense probably damaging 1.00
R1838:Myo5c UTSW 9 75273553 missense probably damaging 1.00
R1840:Myo5c UTSW 9 75249735 missense probably damaging 1.00
R1885:Myo5c UTSW 9 75249761 missense probably damaging 1.00
R1897:Myo5c UTSW 9 75292241 missense probably benign 0.20
R1898:Myo5c UTSW 9 75297626 missense probably damaging 1.00
R2029:Myo5c UTSW 9 75289055 unclassified probably benign
R2063:Myo5c UTSW 9 75281868 missense probably benign 0.19
R2230:Myo5c UTSW 9 75273606 missense probably benign
R2519:Myo5c UTSW 9 75250436 missense probably damaging 1.00
R2520:Myo5c UTSW 9 75297649 nonsense probably null
R3034:Myo5c UTSW 9 75286577 missense probably benign 0.44
R3117:Myo5c UTSW 9 75266194 critical splice donor site probably null
R3432:Myo5c UTSW 9 75263001 missense probably damaging 1.00
R3751:Myo5c UTSW 9 75276002 missense probably damaging 1.00
R4132:Myo5c UTSW 9 75252568 missense probably benign 0.00
R4173:Myo5c UTSW 9 75246258 missense probably damaging 1.00
R4239:Myo5c UTSW 9 75283942 missense probably benign 0.01
R4429:Myo5c UTSW 9 75294001 missense probably damaging 1.00
R4574:Myo5c UTSW 9 75269611 missense probably benign 0.00
R4791:Myo5c UTSW 9 75290916 missense probably damaging 1.00
R4804:Myo5c UTSW 9 75245024 missense probably damaging 1.00
R4819:Myo5c UTSW 9 75292202 missense probably damaging 0.97
R4900:Myo5c UTSW 9 75273543 missense probably damaging 1.00
R4964:Myo5c UTSW 9 75297509 missense possibly damaging 0.51
R4966:Myo5c UTSW 9 75269596 missense probably benign 0.03
R5057:Myo5c UTSW 9 75300873 missense probably damaging 1.00
R5347:Myo5c UTSW 9 75295205 missense probably null 1.00
R5399:Myo5c UTSW 9 75288074 missense possibly damaging 0.80
R5440:Myo5c UTSW 9 75258125 missense possibly damaging 0.91
R5569:Myo5c UTSW 9 75273510 missense probably damaging 1.00
R5600:Myo5c UTSW 9 75289154 missense probably benign 0.00
R5606:Myo5c UTSW 9 75275508 missense probably damaging 1.00
R5704:Myo5c UTSW 9 75272903 missense probably benign 0.00
R5798:Myo5c UTSW 9 75284198 missense probably benign 0.04
R5865:Myo5c UTSW 9 75297488 missense probably damaging 0.97
R6034:Myo5c UTSW 9 75255905 missense probably benign 0.05
R6034:Myo5c UTSW 9 75255905 missense probably benign 0.05
R6143:Myo5c UTSW 9 75249809 missense probably damaging 1.00
R6242:Myo5c UTSW 9 75273611 missense probably benign
R6253:Myo5c UTSW 9 75245037 missense probably damaging 1.00
R6264:Myo5c UTSW 9 75275554 missense probably benign
R6307:Myo5c UTSW 9 75272916 missense possibly damaging 0.73
R6358:Myo5c UTSW 9 75296012 missense possibly damaging 0.53
R6450:Myo5c UTSW 9 75286578 missense probably benign 0.26
R6598:Myo5c UTSW 9 75246234 missense probably damaging 1.00
R6618:Myo5c UTSW 9 75275637 critical splice donor site probably null
R6774:Myo5c UTSW 9 75289186 missense probably benign 0.05
R6865:Myo5c UTSW 9 75269596 missense probably benign 0.03
Z1088:Myo5c UTSW 9 75245059 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGCAAGCCCAGAAGATAG -3'
(R):5'- CTTCTTCTGAAATGCACGGACTC -3'

Sequencing Primer
(F):5'- AGCACGTGCAGTCACAG -3'
(R):5'- AATGCACGGACTCTTGGGATC -3'
Posted On2016-03-17