Incidental Mutation 'R4881:Zfc3h1'
ID 375288
Institutional Source Beutler Lab
Gene Symbol Zfc3h1
Ensembl Gene ENSMUSG00000034163
Gene Name zinc finger, C3H1-type containing
Synonyms Ccdc131, Psrc2
Accession Numbers
Essential gene? Probably essential (E-score: 0.943) question?
Stock # R4881 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 115220864-115268677 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 115236647 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 374 (S374P)
Ref Sequence ENSEMBL: ENSMUSP00000044069 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036044]
AlphaFold B2RT41
Predicted Effect probably benign
Transcript: ENSMUST00000036044
AA Change: S374P

PolyPhen 2 Score 0.390 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000044069
Gene: ENSMUSG00000034163
AA Change: S374P

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 29 90 N/A INTRINSIC
low complexity region 120 132 N/A INTRINSIC
low complexity region 143 214 N/A INTRINSIC
coiled coil region 361 393 N/A INTRINSIC
low complexity region 399 432 N/A INTRINSIC
coiled coil region 436 491 N/A INTRINSIC
low complexity region 543 556 N/A INTRINSIC
low complexity region 564 583 N/A INTRINSIC
low complexity region 595 619 N/A INTRINSIC
low complexity region 623 636 N/A INTRINSIC
low complexity region 716 729 N/A INTRINSIC
low complexity region 752 763 N/A INTRINSIC
coiled coil region 826 889 N/A INTRINSIC
coiled coil region 968 1000 N/A INTRINSIC
low complexity region 1001 1015 N/A INTRINSIC
Pfam:zf-C3H1 1187 1208 1.3e-11 PFAM
HAT 1384 1416 1.11e0 SMART
HAT 1418 1449 4.35e2 SMART
Blast:HAT 1495 1538 2e-9 BLAST
HAT 1653 1685 3.31e1 SMART
HAT 1762 1797 7.03e1 SMART
HAT 1922 1954 1.29e-1 SMART
low complexity region 1975 1992 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218674
Meta Mutation Damage Score 0.1325 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T C 7: 119,877,472 (GRCm39) L1040P possibly damaging Het
Acot11 C A 4: 106,612,502 (GRCm39) probably null Het
Aldoart2 C A 12: 55,612,899 (GRCm39) Q275K probably damaging Het
Auts2 T C 5: 131,501,288 (GRCm39) T42A probably damaging Het
Bora C T 14: 99,299,003 (GRCm39) L187F probably damaging Het
Cbln4 A G 2: 171,884,059 (GRCm39) S54P possibly damaging Het
Celsr3 T A 9: 108,721,140 (GRCm39) L2661Q probably damaging Het
Cfap65 T C 1: 74,946,772 (GRCm39) T1313A probably damaging Het
Dbndd2 C A 2: 164,332,225 (GRCm39) probably benign Het
Dennd4a A G 9: 64,746,126 (GRCm39) D4G possibly damaging Het
Dmxl1 T A 18: 50,090,348 (GRCm39) probably benign Het
Dnah7b T C 1: 46,240,478 (GRCm39) C1532R probably damaging Het
Erbb3 A T 10: 128,412,816 (GRCm39) H591Q probably benign Het
Exosc4 T C 15: 76,213,770 (GRCm39) L198P probably damaging Het
F2r A T 13: 95,754,837 (GRCm39) C16S possibly damaging Het
Gtf2h4 A T 17: 35,981,125 (GRCm39) I234N possibly damaging Het
Ift27 A T 15: 78,049,448 (GRCm39) V84D probably damaging Het
Ints10 C T 8: 69,263,256 (GRCm39) A389V probably benign Het
Irs1 TGGGGTGGACATCGAACTGAAGGAG TG 1: 82,265,453 (GRCm39) 913 probably null Het
Klrc2 T A 6: 129,637,471 (GRCm39) T17S possibly damaging Het
Matr3 T A 18: 35,705,428 (GRCm39) S118T probably damaging Het
Mfsd6l C T 11: 68,448,748 (GRCm39) A533V probably benign Het
Msh3 A G 13: 92,402,549 (GRCm39) probably benign Het
Myo5c A G 9: 75,191,434 (GRCm39) M1103V probably benign Het
Niban2 C A 2: 32,812,590 (GRCm39) Y446* probably null Het
Or2y1e T A 11: 49,219,124 (GRCm39) D295E probably benign Het
Or5e1 T C 7: 108,354,612 (GRCm39) L183P probably damaging Het
Or6z3 A T 7: 6,463,753 (GRCm39) M82L probably benign Het
Osbpl3 A T 6: 50,329,764 (GRCm39) D88E possibly damaging Het
Pou1f1 C T 16: 65,328,728 (GRCm39) T149I probably damaging Het
Ppp1r12b G T 1: 134,883,471 (GRCm39) A17E probably benign Het
Pstpip2 T A 18: 77,962,032 (GRCm39) Y267* probably null Het
Rcor1 A G 12: 111,063,986 (GRCm39) D95G probably damaging Het
Rttn T C 18: 89,119,809 (GRCm39) L1748P probably damaging Het
Slco2a1 A G 9: 102,963,031 (GRCm39) K629E possibly damaging Het
Smarcc1 A G 9: 109,964,696 (GRCm39) probably benign Het
Son A G 16: 91,472,397 (GRCm39) K360E probably benign Het
Stab1 A T 14: 30,865,629 (GRCm39) M1753K probably benign Het
Syne2 A G 12: 76,026,593 (GRCm39) I3474V probably damaging Het
Tmem63c A T 12: 87,133,192 (GRCm39) T736S possibly damaging Het
Tmpo G A 10: 90,998,503 (GRCm39) P428L possibly damaging Het
Tmprss11a G T 5: 86,570,432 (GRCm39) Q176K probably damaging Het
Trappc4 A G 9: 44,315,322 (GRCm39) S219P probably damaging Het
Vmn2r117 G T 17: 23,696,859 (GRCm39) P183T probably damaging Het
Vmn2r54 C T 7: 12,363,598 (GRCm39) V432I probably benign Het
Vtcn1 G A 3: 100,799,909 (GRCm39) G257R probably benign Het
Yipf1 T A 4: 107,202,288 (GRCm39) M217K possibly damaging Het
Zfp407 T C 18: 84,577,828 (GRCm39) H1095R probably benign Het
Zfp661 A T 2: 127,420,564 (GRCm39) H78Q probably benign Het
Zfp957 T C 14: 79,450,849 (GRCm39) T317A unknown Het
Zfyve9 T A 4: 108,584,688 (GRCm39) probably null Het
Other mutations in Zfc3h1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00698:Zfc3h1 APN 10 115,255,737 (GRCm39) missense possibly damaging 0.92
IGL00793:Zfc3h1 APN 10 115,252,779 (GRCm39) missense probably benign 0.00
IGL01349:Zfc3h1 APN 10 115,259,353 (GRCm39) missense probably damaging 1.00
IGL01431:Zfc3h1 APN 10 115,259,128 (GRCm39) missense possibly damaging 0.49
IGL02273:Zfc3h1 APN 10 115,263,004 (GRCm39) missense probably benign
IGL02382:Zfc3h1 APN 10 115,252,781 (GRCm39) nonsense probably null
IGL02397:Zfc3h1 APN 10 115,243,890 (GRCm39) missense probably damaging 1.00
IGL02657:Zfc3h1 APN 10 115,247,859 (GRCm39) missense possibly damaging 0.48
IGL02826:Zfc3h1 APN 10 115,236,809 (GRCm39) missense probably benign 0.42
Gnatcatcher UTSW 10 115,236,647 (GRCm39) missense probably benign 0.39
hutton UTSW 10 115,251,153 (GRCm39) missense probably damaging 0.96
passerine UTSW 10 115,249,916 (GRCm39) missense possibly damaging 0.56
R0178_Zfc3h1_655 UTSW 10 115,242,630 (GRCm39) splice site probably benign
vireo UTSW 10 115,255,806 (GRCm39) missense probably benign 0.01
warbler UTSW 10 115,242,388 (GRCm39) missense probably damaging 1.00
PIT4260001:Zfc3h1 UTSW 10 115,226,794 (GRCm39) missense probably damaging 0.99
PIT4354001:Zfc3h1 UTSW 10 115,262,944 (GRCm39) nonsense probably null
R0062:Zfc3h1 UTSW 10 115,252,658 (GRCm39) missense probably benign 0.00
R0062:Zfc3h1 UTSW 10 115,252,658 (GRCm39) missense probably benign 0.00
R0067:Zfc3h1 UTSW 10 115,259,379 (GRCm39) missense possibly damaging 0.88
R0067:Zfc3h1 UTSW 10 115,259,379 (GRCm39) missense possibly damaging 0.88
R0104:Zfc3h1 UTSW 10 115,251,192 (GRCm39) missense possibly damaging 0.66
R0178:Zfc3h1 UTSW 10 115,242,630 (GRCm39) splice site probably benign
R0355:Zfc3h1 UTSW 10 115,245,018 (GRCm39) missense possibly damaging 0.80
R0619:Zfc3h1 UTSW 10 115,256,715 (GRCm39) missense possibly damaging 0.92
R0731:Zfc3h1 UTSW 10 115,246,537 (GRCm39) missense probably benign 0.00
R0828:Zfc3h1 UTSW 10 115,237,612 (GRCm39) missense possibly damaging 0.68
R0866:Zfc3h1 UTSW 10 115,263,621 (GRCm39) missense probably benign 0.00
R1196:Zfc3h1 UTSW 10 115,247,866 (GRCm39) missense probably damaging 0.99
R1455:Zfc3h1 UTSW 10 115,248,013 (GRCm39) missense probably benign 0.11
R1515:Zfc3h1 UTSW 10 115,252,647 (GRCm39) missense probably benign 0.29
R1617:Zfc3h1 UTSW 10 115,226,827 (GRCm39) missense probably benign 0.01
R1640:Zfc3h1 UTSW 10 115,242,806 (GRCm39) splice site probably null
R1959:Zfc3h1 UTSW 10 115,259,158 (GRCm39) missense probably benign 0.34
R2039:Zfc3h1 UTSW 10 115,242,388 (GRCm39) missense probably damaging 1.00
R3430:Zfc3h1 UTSW 10 115,246,428 (GRCm39) splice site probably benign
R3691:Zfc3h1 UTSW 10 115,256,595 (GRCm39) missense probably benign
R3909:Zfc3h1 UTSW 10 115,255,806 (GRCm39) missense probably benign 0.01
R4235:Zfc3h1 UTSW 10 115,254,704 (GRCm39) missense probably benign 0.32
R4684:Zfc3h1 UTSW 10 115,259,290 (GRCm39) missense probably benign 0.03
R4816:Zfc3h1 UTSW 10 115,251,599 (GRCm39) missense probably benign 0.16
R4883:Zfc3h1 UTSW 10 115,246,547 (GRCm39) missense probably damaging 1.00
R5038:Zfc3h1 UTSW 10 115,240,116 (GRCm39) missense probably benign 0.16
R5068:Zfc3h1 UTSW 10 115,254,688 (GRCm39) nonsense probably null
R5069:Zfc3h1 UTSW 10 115,254,688 (GRCm39) nonsense probably null
R5070:Zfc3h1 UTSW 10 115,254,688 (GRCm39) nonsense probably null
R5155:Zfc3h1 UTSW 10 115,248,026 (GRCm39) missense possibly damaging 0.64
R5190:Zfc3h1 UTSW 10 115,254,597 (GRCm39) missense probably damaging 1.00
R5499:Zfc3h1 UTSW 10 115,246,598 (GRCm39) missense probably damaging 1.00
R5932:Zfc3h1 UTSW 10 115,236,815 (GRCm39) missense probably benign 0.44
R5935:Zfc3h1 UTSW 10 115,267,262 (GRCm39) intron probably benign
R6165:Zfc3h1 UTSW 10 115,256,574 (GRCm39) missense probably benign 0.30
R6182:Zfc3h1 UTSW 10 115,226,764 (GRCm39) missense probably benign 0.00
R6262:Zfc3h1 UTSW 10 115,249,881 (GRCm39) missense probably damaging 1.00
R6382:Zfc3h1 UTSW 10 115,243,813 (GRCm39) missense probably benign 0.06
R6392:Zfc3h1 UTSW 10 115,237,653 (GRCm39) missense probably damaging 1.00
R6539:Zfc3h1 UTSW 10 115,247,907 (GRCm39) missense probably benign 0.26
R6723:Zfc3h1 UTSW 10 115,256,638 (GRCm39) missense probably benign 0.34
R7339:Zfc3h1 UTSW 10 115,239,205 (GRCm39) missense probably damaging 1.00
R7381:Zfc3h1 UTSW 10 115,260,535 (GRCm39) missense probably benign
R7404:Zfc3h1 UTSW 10 115,251,153 (GRCm39) missense probably damaging 0.96
R7667:Zfc3h1 UTSW 10 115,246,606 (GRCm39) nonsense probably null
R7748:Zfc3h1 UTSW 10 115,236,720 (GRCm39) missense probably benign 0.27
R7910:Zfc3h1 UTSW 10 115,256,588 (GRCm39) nonsense probably null
R7914:Zfc3h1 UTSW 10 115,239,062 (GRCm39) splice site probably null
R8023:Zfc3h1 UTSW 10 115,256,553 (GRCm39) missense probably damaging 1.00
R8169:Zfc3h1 UTSW 10 115,254,616 (GRCm39) missense probably damaging 0.98
R8358:Zfc3h1 UTSW 10 115,240,198 (GRCm39) missense probably benign 0.13
R8746:Zfc3h1 UTSW 10 115,243,885 (GRCm39) missense probably damaging 1.00
R8803:Zfc3h1 UTSW 10 115,247,800 (GRCm39) missense probably benign
R8905:Zfc3h1 UTSW 10 115,259,383 (GRCm39) missense probably benign 0.05
R9045:Zfc3h1 UTSW 10 115,263,319 (GRCm39) missense possibly damaging 0.49
R9164:Zfc3h1 UTSW 10 115,259,374 (GRCm39) missense probably benign 0.17
R9211:Zfc3h1 UTSW 10 115,248,328 (GRCm39) missense possibly damaging 0.83
R9216:Zfc3h1 UTSW 10 115,221,528 (GRCm39) missense unknown
R9305:Zfc3h1 UTSW 10 115,255,771 (GRCm39) missense probably benign 0.19
R9372:Zfc3h1 UTSW 10 115,221,223 (GRCm39) missense unknown
R9394:Zfc3h1 UTSW 10 115,254,600 (GRCm39) missense probably damaging 1.00
R9414:Zfc3h1 UTSW 10 115,249,916 (GRCm39) missense possibly damaging 0.56
R9538:Zfc3h1 UTSW 10 115,221,197 (GRCm39) missense unknown
R9623:Zfc3h1 UTSW 10 115,259,362 (GRCm39) missense possibly damaging 0.94
R9633:Zfc3h1 UTSW 10 115,247,852 (GRCm39) missense probably damaging 1.00
R9747:Zfc3h1 UTSW 10 115,244,821 (GRCm39) missense possibly damaging 0.58
Z1176:Zfc3h1 UTSW 10 115,243,907 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGTTGTCCCGCTCTTAATGC -3'
(R):5'- AGAAAGCGCATCACCTGTGG -3'

Sequencing Primer
(F):5'- TGCTTCATGTCTGCATATTTACATAC -3'
(R):5'- ATCACCTGTGGCGCTCAC -3'
Posted On 2016-03-17