Incidental Mutation 'R4882:Ifna9'
ID375318
Institutional Source Beutler Lab
Gene Symbol Ifna9
Ensembl Gene ENSMUSG00000095270
Gene Nameinterferon alpha 9
SynonymsIfa9
MMRRC Submission 042490-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R4882 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location88591813-88592385 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 88592303 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 28 (Q28L)
Ref Sequence ENSEMBL: ENSMUSP00000099871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102807]
Predicted Effect probably benign
Transcript: ENSMUST00000102807
AA Change: Q28L

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000099871
Gene: ENSMUSG00000095270
AA Change: Q28L

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IFabd 58 175 1.68e-67 SMART
Meta Mutation Damage Score 0.166 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap3 A G 4: 155,905,655 D764G probably damaging Het
Adgrg6 T A 10: 14,434,337 I775F possibly damaging Het
Ahnak T A 19: 9,005,897 M1515K probably damaging Het
Aqp4 A G 18: 15,398,254 V150A possibly damaging Het
Axdnd1 A T 1: 156,395,559 probably null Het
Bap1 C T 14: 31,251,721 probably benign Het
BB014433 A G 8: 15,042,016 V279A probably benign Het
Cacng8 T C 7: 3,412,153 Y151H probably damaging Het
Caskin1 T C 17: 24,504,415 S726P probably damaging Het
Cd200 T C 16: 45,397,017 T104A probably benign Het
Cdk12 C T 11: 98,210,446 R377C unknown Het
Ceacam13 A G 7: 18,013,072 H150R probably benign Het
Cebpzos T C 17: 78,919,791 Y65H probably benign Het
Cgnl1 T A 9: 71,717,401 M630L probably benign Het
Dopey2 G T 16: 93,752,914 R247L possibly damaging Het
Dqx1 A G 6: 83,066,088 probably null Het
Etaa1 T C 11: 17,946,174 S648G probably benign Het
Flnb A G 14: 7,929,936 D2022G possibly damaging Het
Gpr158 T A 2: 21,825,248 N701K probably damaging Het
H2-Eb2 C T 17: 34,334,256 H139Y probably benign Het
Hbb-bh2 A T 7: 103,839,248 V114E probably damaging Het
Inca1 T C 11: 70,688,740 T188A probably benign Het
Irf9 G T 14: 55,609,039 probably benign Het
Kdm1b T A 13: 47,060,893 H238Q probably benign Het
Lpin1 G C 12: 16,538,536 F851L probably damaging Het
Map3k9 C T 12: 81,724,162 R884Q probably damaging Het
Mcm3ap C T 10: 76,484,661 Q818* probably null Het
Mcm7 A T 5: 138,165,911 probably null Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Nppa G T 4: 148,001,087 M50I probably benign Het
Opcml G A 9: 28,901,590 E193K probably damaging Het
Phf14 T A 6: 11,988,757 N665K possibly damaging Het
Plekhh3 G A 11: 101,165,183 A47V probably damaging Het
Plekhh3 T A 11: 101,167,938 E156V probably null Het
Prpf19 T C 19: 10,898,959 probably benign Het
Rev3l T A 10: 39,821,460 V651E possibly damaging Het
Sgpl1 T C 10: 61,112,265 N171S probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slx4 T C 16: 3,980,996 probably null Het
Smchd1 T A 17: 71,358,239 probably benign Het
Snca A G 6: 60,815,735 V63A probably benign Het
Taok3 A T 5: 117,252,630 Q92L probably damaging Het
Uhrf1 T C 17: 56,309,401 V73A probably damaging Het
Usp38 G A 8: 80,981,977 Q991* probably null Het
Vmn2r96 T A 17: 18,597,604 V673E probably damaging Het
Zan A G 5: 137,438,448 Y2048H unknown Het
Zfp759 T A 13: 67,139,290 Y302N probably damaging Het
Other mutations in Ifna9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01788:Ifna9 APN 4 88591860 missense probably damaging 1.00
IGL02268:Ifna9 APN 4 88592354 nonsense probably null
R0579:Ifna9 UTSW 4 88592271 missense possibly damaging 0.84
R1530:Ifna9 UTSW 4 88592172 missense possibly damaging 0.83
R1663:Ifna9 UTSW 4 88591983 missense probably benign 0.00
R1872:Ifna9 UTSW 4 88592255 missense probably damaging 0.97
R3923:Ifna9 UTSW 4 88592271 missense possibly damaging 0.84
R4534:Ifna9 UTSW 4 88592048 missense possibly damaging 0.76
R5440:Ifna9 UTSW 4 88591811 unclassified probably null
R6008:Ifna9 UTSW 4 88592363 missense probably null 1.00
R6464:Ifna9 UTSW 4 88592250 missense possibly damaging 0.93
R6584:Ifna9 UTSW 4 88592138 missense probably damaging 0.99
R6899:Ifna9 UTSW 4 88592063 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCATTCCAAGCAGCAGATG -3'
(R):5'- AGACACATCTACATAGGATGGTCTTC -3'

Sequencing Primer
(F):5'- CCAAGCAGCAGATGAGTCCTTTG -3'
(R):5'- CTACATAGGATGGTCTTCAGAGAACC -3'
Posted On2016-03-17