Incidental Mutation 'R4882:Vmn2r96'
ID375356
Institutional Source Beutler Lab
Gene Symbol Vmn2r96
Ensembl Gene ENSMUSG00000091679
Gene Namevomeronasal 2, receptor 96
SynonymsEG433070
MMRRC Submission 042490-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.176) question?
Stock #R4882 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location18573151-18616003 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 18597604 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 673 (V673E)
Ref Sequence ENSEMBL: ENSMUSP00000156012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165692] [ENSMUST00000177244] [ENSMUST00000231261] [ENSMUST00000231286]
Predicted Effect probably damaging
Transcript: ENSMUST00000165692
AA Change: V481E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131564
Gene: ENSMUSG00000091679
AA Change: V481E

DomainStartEndE-ValueType
Pfam:ANF_receptor 1 257 8.6e-20 PFAM
Pfam:NCD3G 317 370 3.7e-22 PFAM
Pfam:7tm_3 402 638 3.9e-53 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000177244
AA Change: V673E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135095
Gene: ENSMUSG00000091679
AA Change: V673E

DomainStartEndE-ValueType
Pfam:ANF_receptor 1 245 4.2e-19 PFAM
Pfam:NCD3G 317 370 6.9e-21 PFAM
Pfam:7tm_3 400 639 3.4e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231261
Predicted Effect probably damaging
Transcript: ENSMUST00000231286
AA Change: V673E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.032 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap3 A G 4: 155,905,655 D764G probably damaging Het
Adgrg6 T A 10: 14,434,337 I775F possibly damaging Het
Ahnak T A 19: 9,005,897 M1515K probably damaging Het
Aqp4 A G 18: 15,398,254 V150A possibly damaging Het
Axdnd1 A T 1: 156,395,559 probably null Het
Bap1 C T 14: 31,251,721 probably benign Het
BB014433 A G 8: 15,042,016 V279A probably benign Het
Cacng8 T C 7: 3,412,153 Y151H probably damaging Het
Caskin1 T C 17: 24,504,415 S726P probably damaging Het
Cd200 T C 16: 45,397,017 T104A probably benign Het
Cdk12 C T 11: 98,210,446 R377C unknown Het
Ceacam13 A G 7: 18,013,072 H150R probably benign Het
Cebpzos T C 17: 78,919,791 Y65H probably benign Het
Cgnl1 T A 9: 71,717,401 M630L probably benign Het
Dopey2 G T 16: 93,752,914 R247L possibly damaging Het
Dqx1 A G 6: 83,066,088 probably null Het
Etaa1 T C 11: 17,946,174 S648G probably benign Het
Flnb A G 14: 7,929,936 D2022G possibly damaging Het
Gpr158 T A 2: 21,825,248 N701K probably damaging Het
H2-Eb2 C T 17: 34,334,256 H139Y probably benign Het
Hbb-bh2 A T 7: 103,839,248 V114E probably damaging Het
Ifna9 T A 4: 88,592,303 Q28L probably benign Het
Inca1 T C 11: 70,688,740 T188A probably benign Het
Irf9 G T 14: 55,609,039 probably benign Het
Kdm1b T A 13: 47,060,893 H238Q probably benign Het
Lpin1 G C 12: 16,538,536 F851L probably damaging Het
Map3k9 C T 12: 81,724,162 R884Q probably damaging Het
Mcm3ap C T 10: 76,484,661 Q818* probably null Het
Mcm7 A T 5: 138,165,911 probably null Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Nppa G T 4: 148,001,087 M50I probably benign Het
Opcml G A 9: 28,901,590 E193K probably damaging Het
Phf14 T A 6: 11,988,757 N665K possibly damaging Het
Plekhh3 G A 11: 101,165,183 A47V probably damaging Het
Plekhh3 T A 11: 101,167,938 E156V probably null Het
Prpf19 T C 19: 10,898,959 probably benign Het
Rev3l T A 10: 39,821,460 V651E possibly damaging Het
Sgpl1 T C 10: 61,112,265 N171S probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slx4 T C 16: 3,980,996 probably null Het
Smchd1 T A 17: 71,358,239 probably benign Het
Snca A G 6: 60,815,735 V63A probably benign Het
Taok3 A T 5: 117,252,630 Q92L probably damaging Het
Uhrf1 T C 17: 56,309,401 V73A probably damaging Het
Usp38 G A 8: 80,981,977 Q991* probably null Het
Zan A G 5: 137,438,448 Y2048H unknown Het
Zfp759 T A 13: 67,139,290 Y302N probably damaging Het
Other mutations in Vmn2r96
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00562:Vmn2r96 APN 17 18583815 missense probably benign 0.00
IGL00563:Vmn2r96 APN 17 18583815 missense probably benign 0.00
IGL00769:Vmn2r96 APN 17 18583819 missense probably benign 0.00
IGL01314:Vmn2r96 APN 17 18582964 missense probably benign 0.00
IGL01983:Vmn2r96 APN 17 18597265 missense probably damaging 0.99
IGL02314:Vmn2r96 APN 17 18583959 missense probably benign 0.01
IGL02600:Vmn2r96 APN 17 18597567 missense probably benign
IGL02672:Vmn2r96 APN 17 18598114 missense probably benign 0.02
IGL02750:Vmn2r96 APN 17 18582589 missense probably benign 0.01
IGL03068:Vmn2r96 APN 17 18582875 missense probably benign 0.00
IGL03411:Vmn2r96 APN 17 18586372 missense possibly damaging 0.88
R0316:Vmn2r96 UTSW 17 18582565 missense probably damaging 1.00
R0502:Vmn2r96 UTSW 17 18584000 missense probably benign
R0580:Vmn2r96 UTSW 17 18582638 missense probably damaging 1.00
R0652:Vmn2r96 UTSW 17 18597568 missense probably benign 0.05
R0789:Vmn2r96 UTSW 17 18582476 missense possibly damaging 0.81
R1462:Vmn2r96 UTSW 17 18597398 missense possibly damaging 0.94
R1462:Vmn2r96 UTSW 17 18597398 missense possibly damaging 0.94
R1660:Vmn2r96 UTSW 17 18597726 missense probably benign 0.00
R1755:Vmn2r96 UTSW 17 18582653 missense possibly damaging 0.50
R1843:Vmn2r96 UTSW 17 18597921 missense probably benign 0.14
R1943:Vmn2r96 UTSW 17 18586402 missense probably benign 0.09
R1993:Vmn2r96 UTSW 17 18583876 missense probably damaging 1.00
R2018:Vmn2r96 UTSW 17 18584001 missense probably benign
R2405:Vmn2r96 UTSW 17 18597840 missense probably damaging 0.96
R3977:Vmn2r96 UTSW 17 18597679 missense probably damaging 1.00
R3979:Vmn2r96 UTSW 17 18597679 missense probably damaging 1.00
R4059:Vmn2r96 UTSW 17 18598077 missense probably benign 0.20
R4693:Vmn2r96 UTSW 17 18583008 missense probably benign 0.03
R4709:Vmn2r96 UTSW 17 18582826 missense probably benign 0.36
R4776:Vmn2r96 UTSW 17 18597508 missense probably damaging 1.00
R4920:Vmn2r96 UTSW 17 18582656 missense probably benign 0.07
R5143:Vmn2r96 UTSW 17 18583858 missense possibly damaging 0.65
R5301:Vmn2r96 UTSW 17 18597688 missense probably damaging 0.98
R5507:Vmn2r96 UTSW 17 18597829 missense probably damaging 1.00
R6151:Vmn2r96 UTSW 17 18583959 missense probably benign 0.01
R6181:Vmn2r96 UTSW 17 18583864 missense probably benign
R6339:Vmn2r96 UTSW 17 18583862 missense possibly damaging 0.84
R6404:Vmn2r96 UTSW 17 18597531 missense probably damaging 1.00
R6452:Vmn2r96 UTSW 17 18583855 missense probably benign 0.07
R6749:Vmn2r96 UTSW 17 18598090 missense probably damaging 0.99
R6813:Vmn2r96 UTSW 17 18581854 missense probably benign 0.04
R6851:Vmn2r96 UTSW 17 18582538 missense possibly damaging 0.95
R6944:Vmn2r96 UTSW 17 18597629 missense probably benign 0.16
R6949:Vmn2r96 UTSW 17 18597838 missense probably damaging 1.00
R6962:Vmn2r96 UTSW 17 18598021 missense probably damaging 0.99
R6990:Vmn2r96 UTSW 17 18583820 missense probably benign
R7149:Vmn2r96 UTSW 17 18597727 missense possibly damaging 0.89
R7346:Vmn2r96 UTSW 17 18582767 missense probably benign 0.15
R7385:Vmn2r96 UTSW 17 18583040 missense probably damaging 1.00
R7442:Vmn2r96 UTSW 17 18573400 missense probably benign 0.02
Z1088:Vmn2r96 UTSW 17 18597366 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- AGACACTCCTATTGTCAAGGC -3'
(R):5'- CACAGATGAGCCCTTGTTGC -3'

Sequencing Primer
(F):5'- GGCAAATAATCGAGCTCTGAGTTAC -3'
(R):5'- GAGCCCTTGTTGCACAAAATG -3'
Posted On2016-03-17