Incidental Mutation 'R0281:Col6a6'
ID37537
Institutional Source Beutler Lab
Gene Symbol Col6a6
Ensembl Gene ENSMUSG00000043719
Gene Namecollagen, type VI, alpha 6
SynonymsE330026B02Rik
MMRRC Submission 038503-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R0281 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location105687809-105828160 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 105784116 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 265 (M265L)
Ref Sequence ENSEMBL: ENSMUSP00000096040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060896] [ENSMUST00000098441] [ENSMUST00000166431]
Predicted Effect probably benign
Transcript: ENSMUST00000060896
AA Change: M265L

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000060840
Gene: ENSMUSG00000043719
AA Change: M265L

DomainStartEndE-ValueType
VWA 24 197 4.26e-26 SMART
VWA 226 407 1.06e-30 SMART
VWA 433 610 5.19e-39 SMART
VWA 619 795 3.58e-42 SMART
VWA 806 982 6.64e-37 SMART
VWA 997 1175 2.7e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098441
AA Change: M265L

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000096040
Gene: ENSMUSG00000043719
AA Change: M265L

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
VWA 24 197 4.26e-26 SMART
VWA 226 407 1.06e-30 SMART
VWA 433 610 5.19e-39 SMART
VWA 619 795 3.58e-42 SMART
VWA 806 982 6.64e-37 SMART
VWA 997 1175 2.7e-37 SMART
VWA 1184 1370 3.45e-1 SMART
Pfam:Collagen 1389 1450 3.3e-9 PFAM
low complexity region 1451 1475 N/A INTRINSIC
low complexity region 1490 1508 N/A INTRINSIC
low complexity region 1602 1623 N/A INTRINSIC
low complexity region 1698 1724 N/A INTRINSIC
VWA 1754 1937 1.73e-17 SMART
VWA 1962 2145 4.4e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166431
AA Change: M265L

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000125765
Gene: ENSMUSG00000043719
AA Change: M265L

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
VWA 24 197 4.26e-26 SMART
VWA 226 407 1.06e-30 SMART
VWA 433 610 5.19e-39 SMART
VWA 619 795 3.58e-42 SMART
VWA 806 982 6.64e-37 SMART
VWA 997 1175 2.7e-37 SMART
VWA 1184 1370 3.45e-1 SMART
Pfam:Collagen 1389 1450 9.3e-10 PFAM
low complexity region 1451 1475 N/A INTRINSIC
low complexity region 1490 1508 N/A INTRINSIC
low complexity region 1602 1623 N/A INTRINSIC
low complexity region 1698 1724 N/A INTRINSIC
VWA 1754 1937 1.73e-17 SMART
VWA 1962 2145 4.4e-19 SMART
Meta Mutation Damage Score 0.038 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 98% (104/106)
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
2610507B11Rik C T 11: 78,271,924 L871F possibly damaging Het
4933430I17Rik A T 4: 62,546,067 R374* probably null Het
5930422O12Rik A T 8: 33,429,379 R76* probably null Het
A1cf G A 19: 31,945,814 A505T probably benign Het
Abcc5 T A 16: 20,422,400 I12F probably damaging Het
Abcf2 T C 5: 24,566,564 E555G probably damaging Het
Acan A T 7: 79,100,285 E1601D probably damaging Het
Adam2 T A 14: 66,037,606 K559N probably benign Het
Akap11 A C 14: 78,510,089 D1619E possibly damaging Het
Ankrd11 T C 8: 122,895,568 D515G probably benign Het
Ankrd27 T A 7: 35,619,371 N562K probably damaging Het
Atp10b T C 11: 43,153,304 I119T probably benign Het
Atr T C 9: 95,937,566 I2202T probably benign Het
BC067074 A T 13: 113,369,143 I727F probably damaging Het
Brd4 T A 17: 32,213,540 probably benign Het
Catsperg2 C T 7: 29,706,571 C634Y possibly damaging Het
Cep192 A G 18: 67,828,482 probably benign Het
Cfap65 T A 1: 74,927,071 I366F probably damaging Het
Cnga4 G T 7: 105,407,668 R326L probably damaging Het
Cntnap5b T A 1: 100,072,153 M212K probably benign Het
Cyp26b1 A T 6: 84,574,556 F417Y probably damaging Het
Dhx15 A T 5: 52,150,746 M768K probably benign Het
Drc7 G A 8: 95,071,253 R433H possibly damaging Het
Duox2 C T 2: 122,292,304 V550M probably benign Het
Elmo2 A G 2: 165,296,890 L456P probably damaging Het
Fbxo39 T C 11: 72,317,530 I236T probably benign Het
Fezf2 A G 14: 12,343,977 C305R probably damaging Het
Fndc3b C A 3: 27,457,006 C785F probably benign Het
Gm12253 T C 11: 58,440,012 probably benign Het
Gnat2 T A 3: 108,095,562 Y95* probably null Het
Gopc T C 10: 52,350,678 K220E probably damaging Het
Hectd4 G A 5: 121,254,251 D193N possibly damaging Het
Hexa G A 9: 59,554,226 probably null Het
Hspa4l T C 3: 40,785,408 probably benign Het
Hspa5 T C 2: 34,774,320 S301P probably damaging Het
Ice1 A T 13: 70,604,047 S1307T possibly damaging Het
Igtp T C 11: 58,206,054 L17P probably damaging Het
Itk T C 11: 46,353,916 Y225C probably damaging Het
Kifc3 A G 8: 95,103,460 V560A probably damaging Het
Lama1 A G 17: 67,817,569 N2875D probably damaging Het
Lasp1 C A 11: 97,806,851 C32* probably null Het
Lcp2 T A 11: 34,069,854 probably benign Het
Lhx9 C T 1: 138,832,904 G236D probably benign Het
Lrrc38 A T 4: 143,350,409 I81F probably damaging Het
Ly6a C T 15: 74,995,387 V94M probably benign Het
Map3k13 A G 16: 21,914,157 E503G probably damaging Het
Mertk T C 2: 128,782,621 probably benign Het
Mkl2 T A 16: 13,412,163 I915N probably damaging Het
Msantd2 G A 9: 37,523,219 D252N possibly damaging Het
Mtmr12 T A 15: 12,257,706 L290* probably null Het
Myo3a T C 2: 22,245,598 I92T probably benign Het
Naglu T A 11: 101,074,027 N313K probably damaging Het
Nceh1 T C 3: 27,222,804 V92A possibly damaging Het
Ncf4 A G 15: 78,250,883 T47A probably damaging Het
Nrp1 T A 8: 128,460,683 F403L probably damaging Het
Nxph3 T C 11: 95,511,256 T111A possibly damaging Het
Obscn T A 11: 59,038,615 E6061V probably damaging Het
Obsl1 C A 1: 75,492,927 G1149W probably damaging Het
Olfr1162 C T 2: 88,050,412 V71I possibly damaging Het
Olfr1370 T A 13: 21,072,374 Y309F probably benign Het
Olfr1487 A G 19: 13,619,485 T65A probably benign Het
Olfr267 A T 4: 58,784,981 V247E probably damaging Het
Olfr292 A G 7: 86,694,860 T135A probably benign Het
Olfr493 A C 7: 108,346,914 D22E probably benign Het
Olfr814 T A 10: 129,874,546 L70F possibly damaging Het
Pde9a T C 17: 31,455,106 V55A probably damaging Het
Pip4k2c A T 10: 127,205,821 probably null Het
Plvap T C 8: 71,511,382 N112S probably damaging Het
Pop1 T A 15: 34,529,858 probably null Het
Ppip5k2 T C 1: 97,716,553 H1113R possibly damaging Het
Ptprk A T 10: 28,573,392 I962F probably damaging Het
Rad51ap2 T C 12: 11,457,042 S322P possibly damaging Het
Rasal1 A G 5: 120,674,605 T565A probably benign Het
Rbm15 C A 3: 107,331,155 R642S probably damaging Het
Rpsa G A 9: 120,131,003 E211K possibly damaging Het
Ryr3 A G 2: 112,686,810 S3303P probably damaging Het
Scg2 T A 1: 79,435,512 N458I possibly damaging Het
Setx A G 2: 29,179,643 T2487A probably benign Het
Slc4a5 G A 6: 83,267,567 probably benign Het
Slc8a2 T A 7: 16,140,989 D387E probably benign Het
Smarcc2 A G 10: 128,474,722 T407A probably benign Het
Snap25 A G 2: 136,777,464 D179G probably damaging Het
Socs4 T C 14: 47,289,868 S74P probably benign Het
Sp6 T A 11: 97,021,925 Y155N probably benign Het
Srrt C T 5: 137,296,127 probably benign Het
Steap1 C T 5: 5,736,431 M335I probably benign Het
Stra6 A T 9: 58,145,489 Y250F probably benign Het
Svil T C 18: 5,094,582 S1421P probably damaging Het
Tcea3 G A 4: 136,271,366 C317Y probably damaging Het
Tmco6 T C 18: 36,737,704 L117S probably damaging Het
Trp53bp1 T C 2: 121,270,237 K89E probably damaging Het
Trp63 T A 16: 25,764,302 probably benign Het
Ube2d2a A G 18: 35,800,132 Y74C probably damaging Het
Usp19 T G 9: 108,498,509 F885V probably damaging Het
Utp18 T A 11: 93,882,177 probably benign Het
Vmn2r116 T C 17: 23,401,413 I707T possibly damaging Het
Vmn2r68 T A 7: 85,233,249 probably benign Het
Vmn2r68 C G 7: 85,233,258 probably null Het
Zfp318 C T 17: 46,412,614 P1848S probably benign Het
Zfp984 G T 4: 147,755,265 N376K probably benign Het
Other mutations in Col6a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Col6a6 APN 9 105758191 critical splice acceptor site probably null
IGL00768:Col6a6 APN 9 105782412 missense probably benign 0.04
IGL00917:Col6a6 APN 9 105784254 splice site probably benign
IGL01385:Col6a6 APN 9 105783666 missense probably damaging 1.00
IGL01411:Col6a6 APN 9 105785958 nonsense probably null
IGL01508:Col6a6 APN 9 105727166 splice site probably benign
IGL01668:Col6a6 APN 9 105709271 missense probably damaging 1.00
IGL01733:Col6a6 APN 9 105709255 missense possibly damaging 0.92
IGL01932:Col6a6 APN 9 105689626 missense probably benign 0.02
IGL01934:Col6a6 APN 9 105698659 critical splice donor site probably null
IGL01944:Col6a6 APN 9 105783909 missense probably damaging 1.00
IGL01980:Col6a6 APN 9 105780985 missense probably damaging 0.96
IGL02114:Col6a6 APN 9 105767199 critical splice donor site probably null
IGL02129:Col6a6 APN 9 105736340 splice site probably benign
IGL02201:Col6a6 APN 9 105780995 missense probably damaging 1.00
IGL02335:Col6a6 APN 9 105784101 missense probably damaging 1.00
IGL02541:Col6a6 APN 9 105732216 missense probably benign 0.05
IGL02574:Col6a6 APN 9 105782191 missense probably damaging 1.00
IGL02649:Col6a6 APN 9 105727170 critical splice donor site probably null
IGL02852:Col6a6 APN 9 105784073 missense probably damaging 0.99
IGL03278:Col6a6 APN 9 105709452 missense probably benign 0.01
IGL03327:Col6a6 APN 9 105767234 missense possibly damaging 0.90
PIT4519001:Col6a6 UTSW 9 105732263 missense probably benign 0.23
R0042:Col6a6 UTSW 9 105780697 missense possibly damaging 0.89
R0046:Col6a6 UTSW 9 105748848 splice site probably benign
R0066:Col6a6 UTSW 9 105702213 missense probably damaging 0.99
R0066:Col6a6 UTSW 9 105702213 missense probably damaging 0.99
R0140:Col6a6 UTSW 9 105702275 missense probably damaging 1.00
R0278:Col6a6 UTSW 9 105767288 missense possibly damaging 0.87
R0382:Col6a6 UTSW 9 105755555 missense probably damaging 0.98
R0389:Col6a6 UTSW 9 105784204 missense probably benign 0.02
R0421:Col6a6 UTSW 9 105784206 missense probably benign 0.02
R0502:Col6a6 UTSW 9 105767351 missense probably benign 0.04
R0503:Col6a6 UTSW 9 105767351 missense probably benign 0.04
R0600:Col6a6 UTSW 9 105761440 missense probably damaging 1.00
R0626:Col6a6 UTSW 9 105777744 missense probably benign 0.45
R0629:Col6a6 UTSW 9 105727165 splice site probably benign
R0690:Col6a6 UTSW 9 105709486 missense probably benign 0.01
R1155:Col6a6 UTSW 9 105782090 missense possibly damaging 0.64
R1245:Col6a6 UTSW 9 105748910 missense possibly damaging 0.62
R1253:Col6a6 UTSW 9 105774303 missense probably null 0.98
R1263:Col6a6 UTSW 9 105709489 missense probably benign 0.01
R1296:Col6a6 UTSW 9 105781091 missense probably damaging 1.00
R1556:Col6a6 UTSW 9 105709473 missense possibly damaging 0.82
R1600:Col6a6 UTSW 9 105778075 missense probably damaging 1.00
R1612:Col6a6 UTSW 9 105777549 missense probably damaging 1.00
R1613:Col6a6 UTSW 9 105732211 critical splice donor site probably null
R1830:Col6a6 UTSW 9 105702270 missense probably damaging 0.99
R1858:Col6a6 UTSW 9 105781102 missense probably damaging 1.00
R1897:Col6a6 UTSW 9 105785744 missense possibly damaging 0.74
R1944:Col6a6 UTSW 9 105709384 missense probably damaging 1.00
R2366:Col6a6 UTSW 9 105755694 missense probably damaging 1.00
R2484:Col6a6 UTSW 9 105780804 missense probably damaging 0.98
R3079:Col6a6 UTSW 9 105754223 missense probably benign 0.01
R3176:Col6a6 UTSW 9 105786230 missense probably benign 0.01
R3276:Col6a6 UTSW 9 105786230 missense probably benign 0.01
R3429:Col6a6 UTSW 9 105777967 missense probably damaging 1.00
R3716:Col6a6 UTSW 9 105782174 missense probably damaging 0.98
R3809:Col6a6 UTSW 9 105780692 missense probably damaging 1.00
R3978:Col6a6 UTSW 9 105698879 missense probably damaging 0.98
R4087:Col6a6 UTSW 9 105783956 missense possibly damaging 0.68
R4382:Col6a6 UTSW 9 105783690 missense probably damaging 1.00
R4516:Col6a6 UTSW 9 105698949 missense possibly damaging 0.64
R4666:Col6a6 UTSW 9 105767342 missense possibly damaging 0.93
R4905:Col6a6 UTSW 9 105767424 missense probably damaging 1.00
R4923:Col6a6 UTSW 9 105788948 missense probably damaging 1.00
R4951:Col6a6 UTSW 9 105767198 critical splice donor site probably null
R5002:Col6a6 UTSW 9 105786093 missense probably benign 0.00
R5111:Col6a6 UTSW 9 105709474 missense possibly damaging 0.70
R5205:Col6a6 UTSW 9 105782033 missense probably damaging 0.99
R5399:Col6a6 UTSW 9 105709107 missense possibly damaging 0.50
R5475:Col6a6 UTSW 9 105774338 missense probably null 0.79
R5491:Col6a6 UTSW 9 105738236 missense probably damaging 0.98
R5758:Col6a6 UTSW 9 105761518 critical splice acceptor site probably null
R5934:Col6a6 UTSW 9 105767075 missense probably damaging 1.00
R6059:Col6a6 UTSW 9 105783917 missense probably damaging 1.00
R6284:Col6a6 UTSW 9 105727227 splice site probably null
R6425:Col6a6 UTSW 9 105698865 missense probably benign 0.21
R6464:Col6a6 UTSW 9 105788953 start codon destroyed probably null 0.60
R6469:Col6a6 UTSW 9 105698691 missense probably damaging 0.97
R6520:Col6a6 UTSW 9 105785825 missense possibly damaging 0.89
R6552:Col6a6 UTSW 9 105698913 missense probably damaging 1.00
R6750:Col6a6 UTSW 9 105783680 missense probably damaging 1.00
R6813:Col6a6 UTSW 9 105783941 missense probably benign 0.32
R7032:Col6a6 UTSW 9 105767508 missense probably damaging 0.96
X0022:Col6a6 UTSW 9 105699332 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCCGTTCTGAGAAGACAGAGACC -3'
(R):5'- GCTGACCTTCCTGAGATAACTGTGC -3'

Sequencing Primer
(F):5'- ATGGTAAAGATGGTCACTCCCTC -3'
(R):5'- CCTGAGATAACTGTGCTGACTC -3'
Posted On2013-05-23