Incidental Mutation 'R4883:Mthfd1l'
ID375424
Institutional Source Beutler Lab
Gene Symbol Mthfd1l
Ensembl Gene ENSMUSG00000040675
Gene Namemethylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like
SynonymsFthfsdc1, 2410004L15Rik
MMRRC Submission 042491-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4883 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location3973118-4167081 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 4007775 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 271 (P271S)
Ref Sequence ENSEMBL: ENSMUSP00000112897 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043735] [ENSMUST00000117291] [ENSMUST00000120585]
Predicted Effect probably benign
Transcript: ENSMUST00000043735
AA Change: P271S

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000036178
Gene: ENSMUSG00000040675
AA Change: P271S

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
low complexity region 30 41 N/A INTRINSIC
Pfam:THF_DHG_CYH 71 179 2.9e-15 PFAM
Pfam:THF_DHG_CYH_C 182 337 1.1e-27 PFAM
Pfam:FTHFS 358 977 1.2e-260 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117291
AA Change: P271S

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000112870
Gene: ENSMUSG00000040675
AA Change: P271S

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
low complexity region 30 41 N/A INTRINSIC
Pfam:THF_DHG_CYH 71 179 2.9e-15 PFAM
Pfam:THF_DHG_CYH_C 182 337 1.1e-27 PFAM
Pfam:FTHFS 358 977 1.2e-260 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120585
AA Change: P271S

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000112897
Gene: ENSMUSG00000040675
AA Change: P271S

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
low complexity region 30 41 N/A INTRINSIC
Pfam:THF_DHG_CYH 70 179 8e-17 PFAM
Pfam:THF_DHG_CYH_C 182 337 5.4e-28 PFAM
Pfam:FTHFS 359 977 7.2e-260 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in the synthesis of tetrahydrofolate (THF) in the mitochondrion. THF is important in the de novo synthesis of purines and thymidylate and in the regeneration of methionine from homocysteine. Several transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jun 2011]
PHENOTYPE: Homozygous deletion of this gene causes embryonic lethality, delayed embryonic growth, craniofacial anomalies, and neural tube defects including craniorachischisis, exencephaly and/or a wavy neural tube. Maternal formate supplementation reduces the incidence of NTDs and improves embryonic growth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011H14Rik T A 14: 49,245,103 N52I probably damaging Het
Abca5 T C 11: 110,326,631 D133G probably damaging Het
Abcg4 G T 9: 44,279,319 H55Q probably damaging Het
Acaca T A 11: 84,251,290 V641E probably benign Het
Adam28 T C 14: 68,638,103 I229V probably damaging Het
Adgrl3 T A 5: 81,689,646 I793N probably damaging Het
Akr1d1 A T 6: 37,558,401 D240V possibly damaging Het
Arhgef25 T C 10: 127,182,933 D548G probably benign Het
Asl A G 5: 130,013,961 probably null Het
Atg14 C T 14: 47,551,314 R194Q probably damaging Het
BC004004 T A 17: 29,282,192 F38L probably damaging Het
Btg1 T C 10: 96,617,397 F25L probably benign Het
Btrc C T 19: 45,456,587 P35S probably benign Het
Calcr T A 6: 3,714,705 N142Y probably damaging Het
Ccdc138 A G 10: 58,561,996 I553V probably benign Het
Cdc42 T A 4: 137,328,804 N132I probably benign Het
Ces1e A G 8: 93,224,088 S22P probably benign Het
Clmn G T 12: 104,782,048 D413E probably benign Het
Cramp1l T C 17: 24,982,319 T730A probably benign Het
Dnah5 A T 15: 28,343,638 M2395L probably benign Het
Ephx1 G T 1: 181,001,923 S20Y possibly damaging Het
Exoc5 T G 14: 49,052,364 E19A probably damaging Het
Fam120b T C 17: 15,403,032 L424P probably benign Het
Fam89a G A 8: 124,741,084 T163I possibly damaging Het
Fcrls G A 3: 87,259,615 L24F possibly damaging Het
Fgd6 G T 10: 94,139,853 V1377L probably benign Het
Glud1 T A 14: 34,335,390 I337K possibly damaging Het
Gm6370 T A 5: 146,493,926 I303N probably benign Het
Gm7995 T C 14: 42,311,426 Y88H probably damaging Het
Gsdma3 T C 11: 98,629,567 probably null Het
Gsdmc2 T C 15: 63,835,765 D60G probably damaging Het
Hcn1 T A 13: 117,902,895 probably null Het
Hectd1 A T 12: 51,784,247 C936* probably null Het
Herc4 T A 10: 63,285,654 S358T probably benign Het
Hk3 A G 13: 55,010,922 C515R probably benign Het
Ighg1 A G 12: 113,327,518 probably benign Het
Iqgap3 T A 3: 88,107,535 C853S probably benign Het
Irx4 G A 13: 73,267,631 A180T probably damaging Het
Kif20b A G 19: 34,966,122 T1441A probably benign Het
Lifr A G 15: 7,185,625 K738E possibly damaging Het
Lmntd2 A T 7: 141,212,618 S218T probably damaging Het
Lnx1 A T 5: 74,607,869 W353R probably benign Het
Lrfn3 G T 7: 30,355,813 P569Q possibly damaging Het
Mamstr A G 7: 45,644,414 I11V probably benign Het
Med31 T C 11: 72,214,149 N32S possibly damaging Het
Mob3c A T 4: 115,833,731 I173F probably benign Het
Morc3 A G 16: 93,870,362 probably null Het
Mphosph9 T C 5: 124,299,045 K412R probably damaging Het
Ncam1 C T 9: 49,541,883 probably null Het
Ncbp3 T A 11: 73,069,752 Y279N probably damaging Het
Ncoa6 G A 2: 155,406,767 T1539I probably benign Het
Nedd4 G A 9: 72,740,233 probably null Het
Neil1 A G 9: 57,146,922 V38A probably damaging Het
Ngf T A 3: 102,520,645 F237I probably damaging Het
Nol3 A G 8: 105,279,256 Q94R possibly damaging Het
Obox1 A G 7: 15,556,338 N202S probably damaging Het
Odc1 T A 12: 17,547,385 N29K possibly damaging Het
Olfr1241 C T 2: 89,482,308 V276I probably benign Het
Olfr132 T C 17: 38,130,617 T192A probably damaging Het
Olfr1535 C T 13: 21,555,488 R178H probably benign Het
Olfr243 A C 7: 103,716,707 I38L probably benign Het
P2rx7 T A 5: 122,681,066 V517E probably damaging Het
Parm1 A G 5: 91,593,916 T48A possibly damaging Het
Pcdh9 T A 14: 93,888,728 D2V possibly damaging Het
Pgm3 G T 9: 86,569,325 T92N probably damaging Het
Plcg2 G T 8: 117,607,133 G882* probably null Het
Ptpn14 C T 1: 189,850,800 P615S probably damaging Het
Ptprk A T 10: 28,588,932 Y1244F probably damaging Het
Rere G A 4: 150,616,053 A1162T probably damaging Het
Rfx2 T C 17: 56,783,747 E391G probably damaging Het
Sema4c A G 1: 36,552,016 V414A probably damaging Het
Serpinb10 A T 1: 107,540,951 N185I probably damaging Het
Shroom3 T G 5: 92,951,134 M1410R probably benign Het
Slc13a1 A T 6: 24,134,357 S176T probably benign Het
Sntb1 A T 15: 55,642,802 Y458* probably null Het
Soga3 A T 10: 29,196,541 N610Y probably damaging Het
Sorcs1 C T 19: 50,232,303 V570I probably benign Het
Sp8 T A 12: 118,849,070 V220E probably damaging Het
Spry1 C T 3: 37,642,719 T37M possibly damaging Het
Sspo A T 6: 48,460,822 H1305L probably benign Het
Tbc1d22a A G 15: 86,496,916 D509G possibly damaging Het
Tmem108 A T 9: 103,499,077 V391D possibly damaging Het
Tmem132d T A 5: 128,269,300 I53F probably damaging Het
Tmem132d T A 5: 128,269,302 H52L possibly damaging Het
Tnnt2 A T 1: 135,847,758 R87* probably null Het
Ube3a A T 7: 59,243,450 M1L probably benign Het
Unc79 A G 12: 103,094,333 T1119A probably damaging Het
Usf3 A T 16: 44,219,579 H1474L probably damaging Het
Vcpip1 G A 1: 9,747,198 T320I probably damaging Het
Vmn1r56 A G 7: 5,196,444 L58P probably damaging Het
Wdr53 A T 16: 32,256,978 K334* probably null Het
Zbtb40 T A 4: 137,000,930 R459W probably benign Het
Zfc3h1 T A 10: 115,410,642 L878Q probably damaging Het
Zfp286 T C 11: 62,780,629 D206G probably benign Het
Zfp46 T A 4: 136,290,481 C209S probably damaging Het
Zufsp G T 10: 33,949,042 T148K probably damaging Het
Other mutations in Mthfd1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00932:Mthfd1l APN 10 3989971 synonymous probably benign
IGL01013:Mthfd1l APN 10 4030716 missense probably damaging 1.00
IGL01018:Mthfd1l APN 10 3978708 missense probably benign
IGL01018:Mthfd1l APN 10 4007800 missense probably benign
IGL01018:Mthfd1l APN 10 4032345 splice site probably benign
IGL01068:Mthfd1l APN 10 4028428 missense probably damaging 1.00
IGL01584:Mthfd1l APN 10 4016738 missense probably damaging 0.97
IGL01609:Mthfd1l APN 10 4018567 missense probably benign 0.00
IGL02272:Mthfd1l APN 10 4041812 missense probably damaging 0.99
IGL02344:Mthfd1l APN 10 4048272 splice site probably null
IGL02429:Mthfd1l APN 10 4089334 missense probably damaging 1.00
IGL02503:Mthfd1l APN 10 4083824 missense probably damaging 1.00
IGL02748:Mthfd1l APN 10 4018587 missense possibly damaging 0.94
IGL02748:Mthfd1l APN 10 3980268 critical splice donor site probably null
IGL03031:Mthfd1l APN 10 4018601 critical splice donor site probably null
IGL03047:Mthfd1l APN 10 3980409 splice site probably benign
IGL03215:Mthfd1l APN 10 4041826 missense probably benign 0.14
IGL03367:Mthfd1l APN 10 4106536 splice site probably benign
R0047:Mthfd1l UTSW 10 3978727 splice site probably benign
R0047:Mthfd1l UTSW 10 3978727 splice site probably benign
R0107:Mthfd1l UTSW 10 4041838 missense probably benign
R0348:Mthfd1l UTSW 10 4056766 missense probably damaging 1.00
R0496:Mthfd1l UTSW 10 4090006 missense probably benign
R0658:Mthfd1l UTSW 10 4047976 splice site probably null
R1177:Mthfd1l UTSW 10 3985661 missense possibly damaging 0.82
R1676:Mthfd1l UTSW 10 4083877 critical splice donor site probably null
R1703:Mthfd1l UTSW 10 4148093 missense probably damaging 1.00
R1888:Mthfd1l UTSW 10 4106528 missense probably damaging 1.00
R1888:Mthfd1l UTSW 10 4106528 missense probably damaging 1.00
R1891:Mthfd1l UTSW 10 4032284 nonsense probably null
R2014:Mthfd1l UTSW 10 4047894 missense probably benign
R2061:Mthfd1l UTSW 10 4103288 missense probably benign 0.00
R2197:Mthfd1l UTSW 10 4028399 missense probably damaging 1.00
R2360:Mthfd1l UTSW 10 4056771 missense probably damaging 1.00
R3085:Mthfd1l UTSW 10 4090007 missense probably benign 0.00
R3176:Mthfd1l UTSW 10 4148025 missense probably damaging 1.00
R3276:Mthfd1l UTSW 10 4148025 missense probably damaging 1.00
R4065:Mthfd1l UTSW 10 4032242 missense probably damaging 1.00
R4612:Mthfd1l UTSW 10 4030717 missense probably damaging 1.00
R4803:Mthfd1l UTSW 10 4007840 missense possibly damaging 0.52
R4932:Mthfd1l UTSW 10 3980241 missense probably benign 0.00
R5507:Mthfd1l UTSW 10 4106432 missense probably benign 0.20
R5687:Mthfd1l UTSW 10 3990002 splice site probably null
R5694:Mthfd1l UTSW 10 4035239 missense possibly damaging 0.90
R5727:Mthfd1l UTSW 10 4103302 missense possibly damaging 0.86
R5908:Mthfd1l UTSW 10 4089392 missense probably damaging 1.00
R5951:Mthfd1l UTSW 10 4048222 missense probably damaging 1.00
R6060:Mthfd1l UTSW 10 4148095 missense probably damaging 1.00
R6330:Mthfd1l UTSW 10 3980234 missense probably benign
R6583:Mthfd1l UTSW 10 4047937 missense probably damaging 0.96
R6846:Mthfd1l UTSW 10 4047898 missense probably damaging 1.00
R7105:Mthfd1l UTSW 10 4103261 missense not run
X0003:Mthfd1l UTSW 10 4089303 missense probably damaging 0.99
Z1088:Mthfd1l UTSW 10 4007844 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTTTGGAATGAAGCTCAGGGTC -3'
(R):5'- ATCTCAAGAATGTGGTCTCCC -3'

Sequencing Primer
(F):5'- CCTGATCTACAAAGTGAGTTCCAGG -3'
(R):5'- TGTGGTCTCCCAAAGAAGC -3'
Posted On2016-03-17