Incidental Mutation 'R4883:Glud1'
ID375455
Institutional Source Beutler Lab
Gene Symbol Glud1
Ensembl Gene ENSMUSG00000021794
Gene Nameglutamate dehydrogenase 1
SynonymsGdh-X, Glud
MMRRC Submission 042491-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.806) question?
Stock #R4883 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location34310727-34345265 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 34335390 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 337 (I337K)
Ref Sequence ENSEMBL: ENSMUSP00000022322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022322]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022322
AA Change: I337K

PolyPhen 2 Score 0.564 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000022322
Gene: ENSMUSG00000021794
AA Change: I337K

DomainStartEndE-ValueType
low complexity region 8 33 N/A INTRINSIC
Pfam:ELFV_dehydrog_N 112 242 1.3e-63 PFAM
ELFV_dehydrog 265 554 1.33e-88 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159784
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161593
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162912
Predicted Effect unknown
Transcript: ENSMUST00000163955
AA Change: I38K
SMART Domains Protein: ENSMUSP00000130934
Gene: ENSMUSG00000021794
AA Change: I38K

DomainStartEndE-ValueType
ELFV_dehydrog 2 139 5.91e-31 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes glutamate dehydrogenase, which is a mitochondrial matrix enzyme that catalyzes the oxidative deamination of glutamate to alpha-ketoglutarate and ammonia. This enzyme has an important role in regulating amino acid-induced insulin secretion. It is allosterically activated by ADP and inhibited by GTP and ATP. Activating mutations in this gene are a common cause of congenital hyperinsulinism. Alternative splicing of this gene results in multiple transcript variants. The related glutamate dehydrogenase 2 gene on the human X-chromosome originated from this gene via retrotransposition and encodes a soluble form of glutamate dehydrogenase. Related pseudogenes have been identified on chromosomes 10, 18 and X. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a conditionally allele activated in beta cells exhibit reduced glucose-stimulated insulin secretion and disorganization of pancreatic islets. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011H14Rik T A 14: 49,245,103 N52I probably damaging Het
Abca5 T C 11: 110,326,631 D133G probably damaging Het
Abcg4 G T 9: 44,279,319 H55Q probably damaging Het
Acaca T A 11: 84,251,290 V641E probably benign Het
Adam28 T C 14: 68,638,103 I229V probably damaging Het
Adgrl3 T A 5: 81,689,646 I793N probably damaging Het
Akr1d1 A T 6: 37,558,401 D240V possibly damaging Het
Arhgef25 T C 10: 127,182,933 D548G probably benign Het
Asl A G 5: 130,013,961 probably null Het
Atg14 C T 14: 47,551,314 R194Q probably damaging Het
BC004004 T A 17: 29,282,192 F38L probably damaging Het
Btg1 T C 10: 96,617,397 F25L probably benign Het
Btrc C T 19: 45,456,587 P35S probably benign Het
Calcr T A 6: 3,714,705 N142Y probably damaging Het
Ccdc138 A G 10: 58,561,996 I553V probably benign Het
Cdc42 T A 4: 137,328,804 N132I probably benign Het
Ces1e A G 8: 93,224,088 S22P probably benign Het
Clmn G T 12: 104,782,048 D413E probably benign Het
Cramp1l T C 17: 24,982,319 T730A probably benign Het
Dnah5 A T 15: 28,343,638 M2395L probably benign Het
Ephx1 G T 1: 181,001,923 S20Y possibly damaging Het
Exoc5 T G 14: 49,052,364 E19A probably damaging Het
Fam120b T C 17: 15,403,032 L424P probably benign Het
Fam89a G A 8: 124,741,084 T163I possibly damaging Het
Fcrls G A 3: 87,259,615 L24F possibly damaging Het
Fgd6 G T 10: 94,139,853 V1377L probably benign Het
Gm6370 T A 5: 146,493,926 I303N probably benign Het
Gm7995 T C 14: 42,311,426 Y88H probably damaging Het
Gsdma3 T C 11: 98,629,567 probably null Het
Gsdmc2 T C 15: 63,835,765 D60G probably damaging Het
Hcn1 T A 13: 117,902,895 probably null Het
Hectd1 A T 12: 51,784,247 C936* probably null Het
Herc4 T A 10: 63,285,654 S358T probably benign Het
Hk3 A G 13: 55,010,922 C515R probably benign Het
Ighg1 A G 12: 113,327,518 probably benign Het
Iqgap3 T A 3: 88,107,535 C853S probably benign Het
Irx4 G A 13: 73,267,631 A180T probably damaging Het
Kif20b A G 19: 34,966,122 T1441A probably benign Het
Lifr A G 15: 7,185,625 K738E possibly damaging Het
Lmntd2 A T 7: 141,212,618 S218T probably damaging Het
Lnx1 A T 5: 74,607,869 W353R probably benign Het
Lrfn3 G T 7: 30,355,813 P569Q possibly damaging Het
Mamstr A G 7: 45,644,414 I11V probably benign Het
Med31 T C 11: 72,214,149 N32S possibly damaging Het
Mob3c A T 4: 115,833,731 I173F probably benign Het
Morc3 A G 16: 93,870,362 probably null Het
Mphosph9 T C 5: 124,299,045 K412R probably damaging Het
Mthfd1l C T 10: 4,007,775 P271S probably benign Het
Ncam1 C T 9: 49,541,883 probably null Het
Ncbp3 T A 11: 73,069,752 Y279N probably damaging Het
Ncoa6 G A 2: 155,406,767 T1539I probably benign Het
Nedd4 G A 9: 72,740,233 probably null Het
Neil1 A G 9: 57,146,922 V38A probably damaging Het
Ngf T A 3: 102,520,645 F237I probably damaging Het
Nol3 A G 8: 105,279,256 Q94R possibly damaging Het
Obox1 A G 7: 15,556,338 N202S probably damaging Het
Odc1 T A 12: 17,547,385 N29K possibly damaging Het
Olfr1241 C T 2: 89,482,308 V276I probably benign Het
Olfr132 T C 17: 38,130,617 T192A probably damaging Het
Olfr1535 C T 13: 21,555,488 R178H probably benign Het
Olfr243 A C 7: 103,716,707 I38L probably benign Het
P2rx7 T A 5: 122,681,066 V517E probably damaging Het
Parm1 A G 5: 91,593,916 T48A possibly damaging Het
Pcdh9 T A 14: 93,888,728 D2V possibly damaging Het
Pgm3 G T 9: 86,569,325 T92N probably damaging Het
Plcg2 G T 8: 117,607,133 G882* probably null Het
Ptpn14 C T 1: 189,850,800 P615S probably damaging Het
Ptprk A T 10: 28,588,932 Y1244F probably damaging Het
Rere G A 4: 150,616,053 A1162T probably damaging Het
Rfx2 T C 17: 56,783,747 E391G probably damaging Het
Sema4c A G 1: 36,552,016 V414A probably damaging Het
Serpinb10 A T 1: 107,540,951 N185I probably damaging Het
Shroom3 T G 5: 92,951,134 M1410R probably benign Het
Slc13a1 A T 6: 24,134,357 S176T probably benign Het
Sntb1 A T 15: 55,642,802 Y458* probably null Het
Soga3 A T 10: 29,196,541 N610Y probably damaging Het
Sorcs1 C T 19: 50,232,303 V570I probably benign Het
Sp8 T A 12: 118,849,070 V220E probably damaging Het
Spry1 C T 3: 37,642,719 T37M possibly damaging Het
Sspo A T 6: 48,460,822 H1305L probably benign Het
Tbc1d22a A G 15: 86,496,916 D509G possibly damaging Het
Tmem108 A T 9: 103,499,077 V391D possibly damaging Het
Tmem132d T A 5: 128,269,300 I53F probably damaging Het
Tmem132d T A 5: 128,269,302 H52L possibly damaging Het
Tnnt2 A T 1: 135,847,758 R87* probably null Het
Ube3a A T 7: 59,243,450 M1L probably benign Het
Unc79 A G 12: 103,094,333 T1119A probably damaging Het
Usf3 A T 16: 44,219,579 H1474L probably damaging Het
Vcpip1 G A 1: 9,747,198 T320I probably damaging Het
Vmn1r56 A G 7: 5,196,444 L58P probably damaging Het
Wdr53 A T 16: 32,256,978 K334* probably null Het
Zbtb40 T A 4: 137,000,930 R459W probably benign Het
Zfc3h1 T A 10: 115,410,642 L878Q probably damaging Het
Zfp286 T C 11: 62,780,629 D206G probably benign Het
Zfp46 T A 4: 136,290,481 C209S probably damaging Het
Zufsp G T 10: 33,949,042 T148K probably damaging Het
Other mutations in Glud1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Glud1 APN 14 34336130 missense probably benign
IGL00973:Glud1 APN 14 34319942 missense probably damaging 1.00
IGL01896:Glud1 APN 14 34319905 missense probably benign 0.00
IGL02442:Glud1 APN 14 34335438 nonsense probably null
IGL03242:Glud1 APN 14 34334280 missense probably benign 0.00
R0009:Glud1 UTSW 14 34334268 missense probably benign
R0009:Glud1 UTSW 14 34334268 missense probably benign
R0845:Glud1 UTSW 14 34329394 unclassified probably benign
R1765:Glud1 UTSW 14 34325584 splice site probably benign
R3870:Glud1 UTSW 14 34325580 splice site probably benign
R4645:Glud1 UTSW 14 34311106 missense probably damaging 1.00
R4773:Glud1 UTSW 14 34321825 critical splice donor site probably null
R5912:Glud1 UTSW 14 34311343 critical splice donor site probably null
R6356:Glud1 UTSW 14 34311216 missense probably benign
R6443:Glud1 UTSW 14 34339927 missense probably benign 0.02
X0013:Glud1 UTSW 14 34338823 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGATTTTGAGACTTGCTTCTAAACC -3'
(R):5'- CTTGGAAGGCAGAGGCTAAC -3'

Sequencing Primer
(F):5'- TGAGACTTGCTTCTAAACCAGTAG -3'
(R):5'- AAGCCCGATGATCTGAGTTC -3'
Posted On2016-03-17