Incidental Mutation 'R4884:Cspg4'
ID375552
Institutional Source Beutler Lab
Gene Symbol Cspg4
Ensembl Gene ENSMUSG00000032911
Gene Namechondroitin sulfate proteoglycan 4
SynonymsAN2, 4732461B14Rik, NG2
MMRRC Submission 041978-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4884 (G1)
Quality Score153
Status Not validated
Chromosome9
Chromosomal Location56865033-56899870 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56898069 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 2055 (W2055R)
Ref Sequence ENSEMBL: ENSMUSP00000038909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035661]
Predicted Effect probably benign
Transcript: ENSMUST00000035661
AA Change: W2055R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000038909
Gene: ENSMUSG00000032911
AA Change: W2055R

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
LamG 47 179 9.16e-22 SMART
LamG 223 364 3.52e-23 SMART
low complexity region 384 397 N/A INTRINSIC
Pfam:Cadherin_3 495 646 1e-36 PFAM
Pfam:Cadherin_3 732 885 7.9e-14 PFAM
Pfam:Cadherin_3 868 996 7e-15 PFAM
Pfam:Cadherin_3 972 1115 9e-26 PFAM
Pfam:Cadherin_3 1116 1223 1.1e-10 PFAM
Pfam:Cadherin_3 1225 1344 3.3e-12 PFAM
Pfam:Cadherin_3 1425 1568 6.3e-52 PFAM
Pfam:Cadherin_3 1578 1684 9.7e-9 PFAM
Pfam:Cadherin_3 1674 1809 3.2e-9 PFAM
Pfam:Cadherin_3 1779 1929 1.6e-31 PFAM
transmembrane domain 2229 2251 N/A INTRINSIC
low complexity region 2295 2305 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215666
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217052
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] A human melanoma-associated chondroitin sulfate proteoglycan plays a role in stabilizing cell-substratum interactions during early events of melanoma cell spreading on endothelial basement membranes. CSPG4 represents an integral membrane chondroitin sulfate proteoglycan expressed by human malignant melanoma cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display abnormal dentate gyrus morphology and abnormal smooth muscle cell physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik A T 6: 96,164,812 M417K probably damaging Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4930452B06Rik G A 14: 8,578,394 T116I probably damaging Het
Aadat C T 8: 60,526,629 P175L probably damaging Het
Acot7 G T 4: 152,186,207 probably benign Het
Adad1 T G 3: 37,076,664 F259V possibly damaging Het
Adora2a A G 10: 75,326,045 Y6C probably null Het
Ahnak A G 19: 9,012,754 probably benign Het
Ankar A T 1: 72,698,807 M72K probably damaging Het
Ankrd45 A G 1: 161,160,700 K176R possibly damaging Het
Ap3m2 T C 8: 22,803,981 K18E probably damaging Het
Apol10b C T 15: 77,588,806 R16Q possibly damaging Het
Atp2b2 T A 6: 113,842,186 T49S possibly damaging Het
B3gntl1 T G 11: 121,629,969 Y206S possibly damaging Het
BC061237 G A 14: 44,501,209 E22K possibly damaging Het
Bmp1 A G 14: 70,475,215 V959A probably benign Het
C530008M17Rik A T 5: 76,848,835 I47F probably damaging Het
Cep295 T C 9: 15,351,760 E169G probably damaging Het
Cfap65 T G 1: 74,903,124 E1757A possibly damaging Het
Cgrrf1 T A 14: 46,853,455 I216N possibly damaging Het
Clstn2 T A 9: 97,799,395 D64V probably damaging Het
Col27a1 T A 4: 63,275,960 D851E possibly damaging Het
Coq9 C T 8: 94,853,194 P259L probably benign Het
Cps1 A G 1: 67,177,024 N836S probably benign Het
Crebbp T C 16: 4,088,375 K1588E probably damaging Het
Cyp3a44 A T 5: 145,777,982 M453K probably damaging Het
Dhx36 T G 3: 62,484,260 D555A probably damaging Het
Dock2 A T 11: 34,266,248 Y1219N probably damaging Het
Dpy19l2 A T 9: 24,628,180 C492* probably null Het
Dusp22 A G 13: 30,668,830 N16S probably benign Het
Epha1 A G 6: 42,360,734 M805T probably damaging Het
Espl1 C T 15: 102,324,070 A2071V possibly damaging Het
Fam160a1 A C 3: 85,683,611 C178G probably damaging Het
Fbxo11 T A 17: 87,992,333 D863V probably damaging Het
Fbxo7 T A 10: 86,029,150 Y106N probably damaging Het
Fst A G 13: 114,454,384 V282A probably damaging Het
Gfra3 T A 18: 34,711,251 M79L probably benign Het
Glp1r T C 17: 30,936,266 V409A probably damaging Het
Gm10799 T A 2: 104,068,207 D51V probably damaging Het
Gm572 C A 4: 148,667,362 T228N possibly damaging Het
Grip1 C T 10: 120,075,306 T643M probably damaging Het
Hdgfl2 C T 17: 56,096,265 R222C possibly damaging Het
Hecw2 T A 1: 53,950,841 I125F probably benign Het
Hipk1 A G 3: 103,744,022 S1153P possibly damaging Het
Insm2 T C 12: 55,599,761 S97P probably damaging Het
Iqca A G 1: 90,140,037 V164A probably benign Het
Kcna6 T C 6: 126,738,726 D400G probably benign Het
Kctd1 T C 18: 14,974,254 Y122C probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Klra2 T C 6: 131,230,202 Y148C probably damaging Het
Krtap31-1 G A 11: 99,908,484 C171Y unknown Het
Ldlrap1 C T 4: 134,758,971 R59Q probably benign Het
Ltb T C 17: 35,195,258 I3T probably benign Het
Macf1 T C 4: 123,455,009 I2477V probably benign Het
Mpdz A T 4: 81,361,476 I39N probably damaging Het
Mycbp2 A G 14: 103,211,295 I1776T probably damaging Het
Myof T A 19: 37,942,357 E994V probably damaging Het
Myom3 A G 4: 135,783,055 E553G possibly damaging Het
Mysm1 A T 4: 94,958,948 C504S probably damaging Het
Nectin3 A T 16: 46,448,886 H384Q probably benign Het
Net1 G A 13: 3,884,252 R482* probably null Het
Nit1 T C 1: 171,343,695 K193R probably null Het
Nlgn1 A G 3: 25,912,674 V205A probably damaging Het
Nr3c2 A T 8: 76,908,809 I180F possibly damaging Het
Nup62 T A 7: 44,828,865 S101R probably damaging Het
Olfr1264 A G 2: 90,021,643 V141A probably benign Het
Olfr1465 A T 19: 13,313,670 I205N probably benign Het
Olfr1489 A T 19: 13,634,027 K305N probably benign Het
Olfr155 T C 4: 43,854,890 S194P probably damaging Het
Olfr355 G T 2: 36,928,012 T34K possibly damaging Het
Olfr508 A T 7: 108,630,612 I207F probably damaging Het
Olfr64 T A 7: 103,893,655 I27F probably benign Het
Olfr663 T A 7: 104,703,861 I98N probably damaging Het
Osbpl6 A T 2: 76,549,539 I158F probably damaging Het
Pcbp4 A G 9: 106,462,102 T103A probably benign Het
Pcdha2 T A 18: 36,940,900 L528Q probably damaging Het
Pcdhga5 T C 18: 37,694,627 S43P probably damaging Het
Pdgfra C A 5: 75,189,312 N952K probably benign Het
Pla2r1 A G 2: 60,534,984 S81P probably damaging Het
Ppp1r32 A T 19: 10,474,501 *428R probably null Het
Rabggtb A T 3: 153,911,931 D43E possibly damaging Het
Rexo5 T A 7: 119,825,551 C43* probably null Het
Robo1 T A 16: 72,904,751 D168E probably damaging Het
Scimp A G 11: 70,798,039 M49T unknown Het
Sema3e T A 5: 14,225,565 V228E probably damaging Het
Sema6d A G 2: 124,656,818 probably null Het
Serpinb6d A T 13: 33,666,445 D85V possibly damaging Het
Slc24a2 C T 4: 86,991,508 V658I probably damaging Het
Snd1 T C 6: 28,526,912 I198T possibly damaging Het
Snx33 C T 9: 56,926,180 V202M probably damaging Het
Soga3 A T 10: 29,196,541 N610Y probably damaging Het
Srcap A G 7: 127,522,017 E174G probably damaging Het
Srgap2 C A 1: 131,292,576 probably null Het
Stxbp5 A T 10: 9,812,341 Y405* probably null Het
Thsd4 C T 9: 59,988,037 R710H probably benign Het
Trp53inp1 T A 4: 11,165,130 D51E probably benign Het
Ttc41 A G 10: 86,731,018 D516G probably benign Het
Uap1l1 A G 2: 25,362,828 V400A probably damaging Het
Vit T C 17: 78,624,753 S430P probably damaging Het
Vmn1r9 T A 6: 57,071,309 M123K possibly damaging Het
Vmn2r14 A T 5: 109,221,518 probably null Het
Vwa3a A G 7: 120,791,701 T746A probably benign Het
Wdfy4 G T 14: 32,988,895 Y2578* probably null Het
Wdr53 A T 16: 32,256,978 K334* probably null Het
Xpot G T 10: 121,606,808 H495Q probably damaging Het
Zcchc6 A T 13: 59,789,452 L775H probably damaging Het
Zfp109 T C 7: 24,229,145 T288A probably benign Het
Zfp277 T A 12: 40,363,153 E276V probably damaging Het
Zfp703 A G 8: 26,978,701 D131G probably benign Het
Zfp985 T A 4: 147,583,344 I223N probably benign Het
Zrsr1 T C 11: 22,973,805 V193A possibly damaging Het
Zscan20 A G 4: 128,588,165 I568T possibly damaging Het
Other mutations in Cspg4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01074:Cspg4 APN 9 56898865 missense probably damaging 1.00
IGL01322:Cspg4 APN 9 56898588 missense probably damaging 1.00
IGL01922:Cspg4 APN 9 56887887 missense probably damaging 1.00
IGL01993:Cspg4 APN 9 56898478 missense probably benign 0.09
IGL02379:Cspg4 APN 9 56892609 splice site probably benign
IGL02398:Cspg4 APN 9 56886686 missense probably benign 0.43
IGL02503:Cspg4 APN 9 56897403 missense probably damaging 1.00
IGL02504:Cspg4 APN 9 56885772 missense probably benign 0.06
IGL02692:Cspg4 APN 9 56887454 missense probably benign 0.00
IGL02728:Cspg4 APN 9 56886481 missense probably damaging 1.00
IGL02806:Cspg4 APN 9 56890259 missense possibly damaging 0.57
IGL02886:Cspg4 APN 9 56897388 missense probably damaging 0.99
IGL03005:Cspg4 APN 9 56888488 missense probably damaging 1.00
IGL03008:Cspg4 APN 9 56898475 missense possibly damaging 0.48
IGL03202:Cspg4 APN 9 56897739 missense possibly damaging 0.93
chiclets UTSW 9 56885222 splice site probably null
R0066:Cspg4 UTSW 9 56888134 missense probably damaging 1.00
R0066:Cspg4 UTSW 9 56888134 missense probably damaging 1.00
R0254:Cspg4 UTSW 9 56897410 missense probably damaging 0.98
R0284:Cspg4 UTSW 9 56886139 missense probably damaging 0.96
R0513:Cspg4 UTSW 9 56898091 missense probably benign 0.03
R0602:Cspg4 UTSW 9 56888017 missense probably damaging 1.00
R0747:Cspg4 UTSW 9 56890280 missense probably damaging 1.00
R1005:Cspg4 UTSW 9 56888736 missense probably benign 0.13
R1421:Cspg4 UTSW 9 56896626 missense probably benign 0.00
R1443:Cspg4 UTSW 9 56886512 missense probably damaging 1.00
R1481:Cspg4 UTSW 9 56887810 missense probably damaging 0.98
R1585:Cspg4 UTSW 9 56898867 missense probably damaging 0.99
R1624:Cspg4 UTSW 9 56888470 missense probably damaging 1.00
R1670:Cspg4 UTSW 9 56897403 missense probably damaging 1.00
R1721:Cspg4 UTSW 9 56888743 missense probably damaging 0.98
R1728:Cspg4 UTSW 9 56898537 missense probably benign 0.00
R1729:Cspg4 UTSW 9 56898537 missense probably benign 0.00
R1763:Cspg4 UTSW 9 56886979 missense probably damaging 0.97
R1772:Cspg4 UTSW 9 56897492 missense probably benign 0.02
R1938:Cspg4 UTSW 9 56887101 missense probably benign 0.00
R1975:Cspg4 UTSW 9 56890478 missense probably damaging 1.00
R2064:Cspg4 UTSW 9 56896656 missense probably damaging 1.00
R2185:Cspg4 UTSW 9 56886972 missense probably benign 0.37
R2252:Cspg4 UTSW 9 56898046 missense probably damaging 1.00
R2291:Cspg4 UTSW 9 56892743 missense probably damaging 0.96
R2329:Cspg4 UTSW 9 56888550 missense probably benign 0.00
R3780:Cspg4 UTSW 9 56888233 missense probably damaging 1.00
R3830:Cspg4 UTSW 9 56897621 missense probably damaging 0.99
R3944:Cspg4 UTSW 9 56886123 missense probably damaging 1.00
R4011:Cspg4 UTSW 9 56887317 missense probably benign 0.19
R4115:Cspg4 UTSW 9 56898394 missense probably damaging 1.00
R4173:Cspg4 UTSW 9 56887930 missense probably damaging 1.00
R4243:Cspg4 UTSW 9 56887857 missense probably benign 0.12
R4329:Cspg4 UTSW 9 56892465 missense probably damaging 0.99
R4544:Cspg4 UTSW 9 56888629 missense possibly damaging 0.79
R4545:Cspg4 UTSW 9 56888629 missense possibly damaging 0.79
R4546:Cspg4 UTSW 9 56888629 missense possibly damaging 0.79
R4649:Cspg4 UTSW 9 56886865 missense possibly damaging 0.93
R4663:Cspg4 UTSW 9 56886676 missense possibly damaging 0.61
R4674:Cspg4 UTSW 9 56898205 missense probably damaging 1.00
R4779:Cspg4 UTSW 9 56885808 missense probably damaging 1.00
R5021:Cspg4 UTSW 9 56897730 missense probably benign 0.01
R5051:Cspg4 UTSW 9 56885736 missense possibly damaging 0.95
R5328:Cspg4 UTSW 9 56885856 missense probably benign 0.01
R5394:Cspg4 UTSW 9 56890200 missense probably damaging 1.00
R5567:Cspg4 UTSW 9 56886648 missense probably benign 0.00
R5682:Cspg4 UTSW 9 56886196 missense probably benign 0.14
R5690:Cspg4 UTSW 9 56898735 missense probably benign 0.01
R5715:Cspg4 UTSW 9 56891051 missense possibly damaging 0.90
R5717:Cspg4 UTSW 9 56885798 missense probably benign
R5726:Cspg4 UTSW 9 56885904 missense probably damaging 1.00
R5898:Cspg4 UTSW 9 56885222 splice site probably null
R6140:Cspg4 UTSW 9 56897224 missense probably benign 0.35
R6147:Cspg4 UTSW 9 56888772 missense probably damaging 0.99
R6239:Cspg4 UTSW 9 56888182 missense probably benign 0.04
R6343:Cspg4 UTSW 9 56892692 missense probably benign
R6351:Cspg4 UTSW 9 56892644 missense probably benign 0.00
R6564:Cspg4 UTSW 9 56890158 missense probably benign 0.02
R6814:Cspg4 UTSW 9 56890340 missense possibly damaging 0.91
R6928:Cspg4 UTSW 9 56897880 missense possibly damaging 0.95
R6967:Cspg4 UTSW 9 56890136 missense possibly damaging 0.52
R6981:Cspg4 UTSW 9 56887101 missense probably benign 0.00
R7033:Cspg4 UTSW 9 56888074 missense probably damaging 0.96
X0065:Cspg4 UTSW 9 56885736 missense possibly damaging 0.95
Z1088:Cspg4 UTSW 9 56886036 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGCTTACCGCCTCACTCAG -3'
(R):5'- TCCACAAGTTGGTTGCTCC -3'

Sequencing Primer
(F):5'- CCTGTATGGGCAGCTACTAGTAG -3'
(R):5'- ACAAGTTGGTTGCTCCTAGATTC -3'
Posted On2016-03-17