Incidental Mutation 'R4885:Eml2'
ID375636
Institutional Source Beutler Lab
Gene Symbol Eml2
Ensembl Gene ENSMUSG00000040811
Gene Nameechinoderm microtubule associated protein like 2
Synonyms1600029N02Rik
MMRRC Submission 042851-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4885 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location19176421-19206482 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 19204010 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 793 (S793N)
Ref Sequence ENSEMBL: ENSMUSP00000112491 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048502] [ENSMUST00000117338] [ENSMUST00000120595] [ENSMUST00000148246]
Predicted Effect probably benign
Transcript: ENSMUST00000048502
AA Change: S620N

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000037654
Gene: ENSMUSG00000040811
AA Change: S620N

DomainStartEndE-ValueType
Pfam:HELP 17 65 4.6e-14 PFAM
WD40 113 162 8.36e-2 SMART
WD40 165 210 9.21e0 SMART
WD40 213 252 7.99e-1 SMART
WD40 258 298 3.7e0 SMART
WD40 301 341 3.58e-1 SMART
WD40 385 424 5.52e-2 SMART
WD40 427 465 1.1e1 SMART
WD40 468 507 4.95e-4 SMART
WD40 514 553 4.62e-4 SMART
WD40 579 620 4.75e1 SMART
WD40 626 666 2.67e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117338
AA Change: S793N

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000112491
Gene: ENSMUSG00000040811
AA Change: S793N

DomainStartEndE-ValueType
low complexity region 2 32 N/A INTRINSIC
coiled coil region 59 106 N/A INTRINSIC
low complexity region 183 191 N/A INTRINSIC
Pfam:HELP 211 285 3.5e-29 PFAM
WD40 286 335 5.5e-4 SMART
WD40 338 383 5.8e-2 SMART
WD40 386 425 5.2e-3 SMART
WD40 431 471 2.4e-2 SMART
WD40 474 514 2.3e-3 SMART
WD40 558 597 3.6e-4 SMART
WD40 600 638 7.1e-2 SMART
WD40 641 680 3.1e-6 SMART
WD40 687 726 3.1e-6 SMART
WD40 752 793 3e-1 SMART
WD40 799 839 1.7e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120595
AA Change: S601N

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000112447
Gene: ENSMUSG00000040811
AA Change: S601N

DomainStartEndE-ValueType
WD40 94 154 2.48e0 SMART
WD40 157 196 7.99e-1 SMART
WD40 202 242 3.7e0 SMART
WD40 245 285 3.58e-1 SMART
WD40 329 368 5.52e-2 SMART
WD40 371 409 1.1e1 SMART
WD40 412 451 4.95e-4 SMART
WD40 458 497 4.62e-4 SMART
WD40 523 564 4.75e1 SMART
WD40 570 610 2.67e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148246
SMART Domains Protein: ENSMUSP00000115466
Gene: ENSMUSG00000040811

DomainStartEndE-ValueType
WD40 94 143 8.36e-2 SMART
WD40 146 191 9.21e0 SMART
WD40 194 233 7.99e-1 SMART
WD40 239 279 3.7e0 SMART
WD40 282 322 3.58e-1 SMART
WD40 366 405 5.52e-2 SMART
Meta Mutation Damage Score 0.146 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 99% (77/78)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 A G 16: 20,551,675 T317A probably benign Het
Adck1 G A 12: 88,441,095 A199T probably benign Het
Adgrb1 A T 15: 74,572,162 M1038L probably benign Het
Anapc10 C T 8: 79,729,150 T76I probably benign Het
Bptf C T 11: 107,074,648 S1177N probably benign Het
Bsn A T 9: 108,107,527 Y337* probably null Het
C77080 C T 4: 129,224,445 R214Q probably damaging Het
C87499 T A 4: 88,627,982 L374F possibly damaging Het
Ccl20 T A 1: 83,117,859 V48E possibly damaging Het
Ccnl1 C T 3: 65,956,899 D122N probably damaging Het
Chat C G 14: 32,454,610 G69A probably damaging Het
Cr2 T A 1: 195,158,731 I418F possibly damaging Het
Dmxl1 G C 18: 49,878,795 A1340P probably damaging Het
Eef2k G A 7: 120,891,932 R547Q probably benign Het
Enox1 T A 14: 77,720,850 L632Q probably damaging Het
Fabp9 T C 3: 10,194,678 K92E probably damaging Het
Fam214a T C 9: 75,006,367 L94P probably damaging Het
Fam234a T C 17: 26,213,585 H530R probably benign Het
Fancm C T 12: 65,102,643 Q728* probably null Het
Fgd3 G A 13: 49,263,989 T666M possibly damaging Het
Foxs1 T C 2: 152,932,381 M251V probably benign Het
Fsip2 A T 2: 82,988,094 M4724L probably benign Het
Gemin6 G A 17: 80,227,898 E96K probably damaging Het
Gfi1 C A 5: 107,723,286 V80F probably damaging Het
Hectd1 A G 12: 51,800,722 V442A probably damaging Het
Hist2h3b G T 3: 96,268,961 V90F possibly damaging Het
Ift80 A G 3: 68,950,496 I272T probably damaging Het
Impact C G 18: 12,986,373 A214G probably damaging Het
Insl6 C T 19: 29,325,156 E54K probably benign Het
Irak3 T A 10: 120,182,681 D54V probably damaging Het
Itk C T 11: 46,336,344 probably null Het
Ivl A T 3: 92,572,411 C116S probably benign Het
Kcnq4 G A 4: 120,713,063 A361V probably benign Het
L1td1 C T 4: 98,737,311 P581L probably benign Het
Lrp1b T C 2: 41,468,893 E656G probably benign Het
Macrod2 A G 2: 140,420,065 T89A possibly damaging Het
Mettl13 T C 1: 162,537,268 D514G probably damaging Het
Mfsd13b A T 7: 120,991,488 I151F possibly damaging Het
Mical3 G A 6: 120,935,253 P1882S probably damaging Het
Mycbp2 T C 14: 103,145,946 E394G possibly damaging Het
Myo16 T A 8: 10,438,892 S688T probably damaging Het
Neb T C 2: 52,286,046 Y1467C probably damaging Het
Nkx6-3 C A 8: 23,153,898 P105Q possibly damaging Het
Nlrp1b T C 11: 71,217,884 T264A possibly damaging Het
Nnat G A 2: 157,561,758 C122Y probably damaging Het
Notch3 G A 17: 32,141,377 R1527C probably damaging Het
Olfr1388 C T 11: 49,444,622 T257I probably damaging Het
Olfr186 A G 16: 59,027,155 Y251H probably damaging Het
Olfr262 T G 19: 12,240,718 probably null Het
Pds5b C T 5: 150,716,462 T14I probably benign Het
Phf19 A T 2: 34,899,706 I334N probably damaging Het
Pik3ap1 T C 19: 41,375,926 D118G probably benign Het
Pkhd1 T A 1: 20,070,488 E3886V possibly damaging Het
Pkp1 A G 1: 135,918,952 S21P possibly damaging Het
Rack1 C A 11: 48,805,636 A290E probably damaging Het
Rbm15 A G 3: 107,332,254 V276A probably benign Het
Rnf216 A T 5: 143,090,580 L183* probably null Het
Sc5d T C 9: 42,255,626 I206V probably benign Het
Scpep1 A G 11: 88,935,911 I233T probably benign Het
Sh3pxd2a A G 19: 47,268,693 Y529H probably damaging Het
Slc1a4 A C 11: 20,304,384 V494G probably damaging Het
Slc38a7 T C 8: 95,848,602 T17A probably benign Het
Smg6 T C 11: 75,041,918 S73P probably damaging Het
Stk32b T C 5: 37,466,797 Y202C probably damaging Het
Tas2r137 A G 6: 40,491,400 S55G probably damaging Het
Tcf12 C T 9: 71,858,840 G504S probably null Het
Ttc3 T C 16: 94,419,465 I568T probably damaging Het
Ttc3 G C 16: 94,426,831 probably null Het
Ttc41 T G 10: 86,759,102 N913K possibly damaging Het
Vrk1 G A 12: 106,057,972 V236M probably damaging Het
Wscd1 C T 11: 71,760,146 R100C probably damaging Het
Zc3h18 C T 8: 122,401,706 probably benign Het
Other mutations in Eml2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00690:Eml2 APN 7 19206143 missense probably damaging 1.00
IGL00786:Eml2 APN 7 19202582 missense probably damaging 1.00
IGL01084:Eml2 APN 7 19190738 nonsense probably null
IGL01132:Eml2 APN 7 19200539 missense probably damaging 1.00
IGL01678:Eml2 APN 7 19186122 missense probably benign 0.38
IGL01800:Eml2 APN 7 19201197 intron probably benign
IGL02517:Eml2 APN 7 19206130 missense probably damaging 1.00
IGL02607:Eml2 APN 7 19206111 missense probably damaging 1.00
IGL02676:Eml2 APN 7 19184921 nonsense probably null
IGL03082:Eml2 APN 7 19201877 missense probably damaging 1.00
puffery UTSW 7 19201163 missense probably damaging 1.00
R0040:Eml2 UTSW 7 19196614 missense possibly damaging 0.48
R0135:Eml2 UTSW 7 19203952 missense probably damaging 1.00
R0240:Eml2 UTSW 7 19184872 nonsense probably null
R0240:Eml2 UTSW 7 19184872 nonsense probably null
R0362:Eml2 UTSW 7 19190806 unclassified probably null
R0387:Eml2 UTSW 7 19182259 splice site probably null
R0432:Eml2 UTSW 7 19179531 nonsense probably null
R0614:Eml2 UTSW 7 19202591 missense probably damaging 1.00
R0628:Eml2 UTSW 7 19201554 splice site probably benign
R1078:Eml2 UTSW 7 19179762 missense probably benign 0.24
R1531:Eml2 UTSW 7 19196254 missense probably damaging 1.00
R1856:Eml2 UTSW 7 19194061 missense probably damaging 0.97
R1864:Eml2 UTSW 7 19201878 missense probably damaging 1.00
R1937:Eml2 UTSW 7 19203964 missense possibly damaging 0.68
R2032:Eml2 UTSW 7 19202555 missense probably benign 0.03
R2185:Eml2 UTSW 7 19194028 missense probably damaging 1.00
R2419:Eml2 UTSW 7 19176695 unclassified probably benign
R3821:Eml2 UTSW 7 19202986 missense possibly damaging 0.94
R4199:Eml2 UTSW 7 19179439 missense probably benign 0.00
R4411:Eml2 UTSW 7 19182401 critical splice donor site probably null
R4497:Eml2 UTSW 7 19179350 missense probably damaging 1.00
R4912:Eml2 UTSW 7 19193999 splice site probably null
R5028:Eml2 UTSW 7 19179447 critical splice donor site probably null
R5192:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R5196:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R5373:Eml2 UTSW 7 19179263 missense possibly damaging 0.92
R5718:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R5719:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R5720:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R5727:Eml2 UTSW 7 19190760 missense probably damaging 0.99
R5841:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R5842:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R5843:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R5844:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6014:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6015:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6017:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6073:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6075:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6126:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6128:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6129:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6189:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6190:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6258:Eml2 UTSW 7 19179364 unclassified probably null
R6273:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6289:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6376:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6378:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6381:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6384:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6394:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6435:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6436:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6437:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6476:Eml2 UTSW 7 19196311 missense probably benign 0.26
R6550:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6551:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6552:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6554:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6572:Eml2 UTSW 7 19196614 missense possibly damaging 0.48
R6598:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6599:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6704:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6705:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6709:Eml2 UTSW 7 19206211 makesense probably null
R6730:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6734:Eml2 UTSW 7 19200507 missense probably benign 0.35
R6742:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6769:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6770:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6864:Eml2 UTSW 7 19196281 missense probably damaging 0.99
R6878:Eml2 UTSW 7 19200612 missense probably benign 0.08
R7045:Eml2 UTSW 7 19201579 missense probably damaging 1.00
R7260:Eml2 UTSW 7 19200590 missense probably benign 0.45
R7478:Eml2 UTSW 7 19206141 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTTACCCAAGGAGGTCTTCAAC -3'
(R):5'- TGGGGAAACTACAGTTCCGAG -3'

Sequencing Primer
(F):5'- TTGTCGTGTCTACAGGGA -3'
(R):5'- CATCTATAATCCTAGCTCTGGGGAG -3'
Posted On2016-03-17