Incidental Mutation 'R0281:Abcc5'
ID37571
Institutional Source Beutler Lab
Gene Symbol Abcc5
Ensembl Gene ENSMUSG00000022822
Gene NameATP-binding cassette, sub-family C (CFTR/MRP), member 5
Synonyms2900011L11Rik, Abcc5a, Mrp5, Abcc5b
MMRRC Submission 038503-MU
Accession Numbers

Ncbi RefSeq: NM_013790.2, NM_176839.1; MGI:1351644

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0281 (G1)
Quality Score141
Status Validated
Chromosome16
Chromosomal Location20331303-20426394 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 20422400 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 12 (I12F)
Ref Sequence ENSEMBL: ENSMUSP00000093913 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077867] [ENSMUST00000079158] [ENSMUST00000096199] [ENSMUST00000115547]
Predicted Effect probably damaging
Transcript: ENSMUST00000077867
AA Change: I12F

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000077031
Gene: ENSMUSG00000022822
AA Change: I12F

DomainStartEndE-ValueType
Pfam:ABC_membrane 179 447 1.6e-18 PFAM
Blast:AAA 463 512 2e-22 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000079158
AA Change: I12F

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000078158
Gene: ENSMUSG00000022822
AA Change: I12F

DomainStartEndE-ValueType
Pfam:ABC_membrane 179 447 1.6e-18 PFAM
low complexity region 552 563 N/A INTRINSIC
AAA 587 760 1.16e-12 SMART
low complexity region 815 826 N/A INTRINSIC
Pfam:ABC_membrane 858 1142 9.3e-36 PFAM
AAA 1218 1403 1.26e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000096199
AA Change: I12F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect possibly damaging
Transcript: ENSMUST00000115547
AA Change: I12F

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000111209
Gene: ENSMUSG00000022822
AA Change: I12F

DomainStartEndE-ValueType
Pfam:ABC_membrane 179 447 2e-17 PFAM
low complexity region 552 563 N/A INTRINSIC
AAA 587 760 1.16e-12 SMART
low complexity region 815 826 N/A INTRINSIC
Pfam:ABC_membrane 858 1146 6.5e-30 PFAM
AAA 1218 1403 1.26e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134962
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231522
Meta Mutation Damage Score 0.068 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 98% (104/106)
MGI Phenotype Strain: 3794119
FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. The human protein functions in the cellular export of its substrate, cyclic nucleotides. This export contributes to the degradation of phosphodiesterases and possibly an elimination pathway for cyclic nucleotides. Studies show that the human protein provides resistance to thiopurine anticancer drugs, 6-mercatopurine and thioguanine, and the anti-HIV drug 9-(2-phosphonylmethoxyethyl)adenine. Two alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display normal cGMP transport into erythrocyte membrane vesicles. [provided by MGI curators]
Allele List at MGI

All alleles(81) : Targeted(4) Gene trapped(77)

Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
2610507B11Rik C T 11: 78,271,924 L871F possibly damaging Het
4933430I17Rik A T 4: 62,546,067 R374* probably null Het
5930422O12Rik A T 8: 33,429,379 R76* probably null Het
A1cf G A 19: 31,945,814 A505T probably benign Het
Abcf2 T C 5: 24,566,564 E555G probably damaging Het
Acan A T 7: 79,100,285 E1601D probably damaging Het
Adam2 T A 14: 66,037,606 K559N probably benign Het
Akap11 A C 14: 78,510,089 D1619E possibly damaging Het
Ankrd11 T C 8: 122,895,568 D515G probably benign Het
Ankrd27 T A 7: 35,619,371 N562K probably damaging Het
Atp10b T C 11: 43,153,304 I119T probably benign Het
Atr T C 9: 95,937,566 I2202T probably benign Het
BC067074 A T 13: 113,369,143 I727F probably damaging Het
Brd4 T A 17: 32,213,540 probably benign Het
Catsperg2 C T 7: 29,706,571 C634Y possibly damaging Het
Cep192 A G 18: 67,828,482 probably benign Het
Cfap65 T A 1: 74,927,071 I366F probably damaging Het
Cnga4 G T 7: 105,407,668 R326L probably damaging Het
Cntnap5b T A 1: 100,072,153 M212K probably benign Het
Col6a6 T A 9: 105,784,116 M265L probably benign Het
Cyp26b1 A T 6: 84,574,556 F417Y probably damaging Het
Dhx15 A T 5: 52,150,746 M768K probably benign Het
Drc7 G A 8: 95,071,253 R433H possibly damaging Het
Duox2 C T 2: 122,292,304 V550M probably benign Het
Elmo2 A G 2: 165,296,890 L456P probably damaging Het
Fbxo39 T C 11: 72,317,530 I236T probably benign Het
Fezf2 A G 14: 12,343,977 C305R probably damaging Het
Fndc3b C A 3: 27,457,006 C785F probably benign Het
Gm12253 T C 11: 58,440,012 probably benign Het
Gnat2 T A 3: 108,095,562 Y95* probably null Het
Gopc T C 10: 52,350,678 K220E probably damaging Het
Hectd4 G A 5: 121,254,251 D193N possibly damaging Het
Hexa G A 9: 59,554,226 probably null Het
Hspa4l T C 3: 40,785,408 probably benign Het
Hspa5 T C 2: 34,774,320 S301P probably damaging Het
Ice1 A T 13: 70,604,047 S1307T possibly damaging Het
Igtp T C 11: 58,206,054 L17P probably damaging Het
Itk T C 11: 46,353,916 Y225C probably damaging Het
Kifc3 A G 8: 95,103,460 V560A probably damaging Het
Lama1 A G 17: 67,817,569 N2875D probably damaging Het
Lasp1 C A 11: 97,806,851 C32* probably null Het
Lcp2 T A 11: 34,069,854 probably benign Het
Lhx9 C T 1: 138,832,904 G236D probably benign Het
Lrrc38 A T 4: 143,350,409 I81F probably damaging Het
Ly6a C T 15: 74,995,387 V94M probably benign Het
Map3k13 A G 16: 21,914,157 E503G probably damaging Het
Mertk T C 2: 128,782,621 probably benign Het
Mkl2 T A 16: 13,412,163 I915N probably damaging Het
Msantd2 G A 9: 37,523,219 D252N possibly damaging Het
Mtmr12 T A 15: 12,257,706 L290* probably null Het
Myo3a T C 2: 22,245,598 I92T probably benign Het
Naglu T A 11: 101,074,027 N313K probably damaging Het
Nceh1 T C 3: 27,222,804 V92A possibly damaging Het
Ncf4 A G 15: 78,250,883 T47A probably damaging Het
Nrp1 T A 8: 128,460,683 F403L probably damaging Het
Nxph3 T C 11: 95,511,256 T111A possibly damaging Het
Obscn T A 11: 59,038,615 E6061V probably damaging Het
Obsl1 C A 1: 75,492,927 G1149W probably damaging Het
Olfr1162 C T 2: 88,050,412 V71I possibly damaging Het
Olfr1370 T A 13: 21,072,374 Y309F probably benign Het
Olfr1487 A G 19: 13,619,485 T65A probably benign Het
Olfr267 A T 4: 58,784,981 V247E probably damaging Het
Olfr292 A G 7: 86,694,860 T135A probably benign Het
Olfr493 A C 7: 108,346,914 D22E probably benign Het
Olfr814 T A 10: 129,874,546 L70F possibly damaging Het
Pde9a T C 17: 31,455,106 V55A probably damaging Het
Pip4k2c A T 10: 127,205,821 probably null Het
Plvap T C 8: 71,511,382 N112S probably damaging Het
Pop1 T A 15: 34,529,858 probably null Het
Ppip5k2 T C 1: 97,716,553 H1113R possibly damaging Het
Ptprk A T 10: 28,573,392 I962F probably damaging Het
Rad51ap2 T C 12: 11,457,042 S322P possibly damaging Het
Rasal1 A G 5: 120,674,605 T565A probably benign Het
Rbm15 C A 3: 107,331,155 R642S probably damaging Het
Rpsa G A 9: 120,131,003 E211K possibly damaging Het
Ryr3 A G 2: 112,686,810 S3303P probably damaging Het
Scg2 T A 1: 79,435,512 N458I possibly damaging Het
Setx A G 2: 29,179,643 T2487A probably benign Het
Slc4a5 G A 6: 83,267,567 probably benign Het
Slc8a2 T A 7: 16,140,989 D387E probably benign Het
Smarcc2 A G 10: 128,474,722 T407A probably benign Het
Snap25 A G 2: 136,777,464 D179G probably damaging Het
Socs4 T C 14: 47,289,868 S74P probably benign Het
Sp6 T A 11: 97,021,925 Y155N probably benign Het
Srrt C T 5: 137,296,127 probably benign Het
Steap1 C T 5: 5,736,431 M335I probably benign Het
Stra6 A T 9: 58,145,489 Y250F probably benign Het
Svil T C 18: 5,094,582 S1421P probably damaging Het
Tcea3 G A 4: 136,271,366 C317Y probably damaging Het
Tmco6 T C 18: 36,737,704 L117S probably damaging Het
Trp53bp1 T C 2: 121,270,237 K89E probably damaging Het
Trp63 T A 16: 25,764,302 probably benign Het
Ube2d2a A G 18: 35,800,132 Y74C probably damaging Het
Usp19 T G 9: 108,498,509 F885V probably damaging Het
Utp18 T A 11: 93,882,177 probably benign Het
Vmn2r116 T C 17: 23,401,413 I707T possibly damaging Het
Vmn2r68 T A 7: 85,233,249 probably benign Het
Vmn2r68 C G 7: 85,233,258 probably null Het
Zfp318 C T 17: 46,412,614 P1848S probably benign Het
Zfp984 G T 4: 147,755,265 N376K probably benign Het
Other mutations in Abcc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00917:Abcc5 APN 16 20422357 missense probably benign 0.01
IGL00928:Abcc5 APN 16 20398970 unclassified probably benign
IGL01350:Abcc5 APN 16 20368458 missense probably benign 0.00
IGL01774:Abcc5 APN 16 20378457 missense probably damaging 1.00
IGL01934:Abcc5 APN 16 20422441 utr 5 prime probably benign
IGL02413:Abcc5 APN 16 20422437 utr 5 prime probably benign
IGL02426:Abcc5 APN 16 20338925 missense probably damaging 0.98
IGL02797:Abcc5 APN 16 20368464 missense probably benign 0.06
IGL02938:Abcc5 APN 16 20362229 missense possibly damaging 0.64
IGL03367:Abcc5 APN 16 20392811 utr 3 prime probably benign
IGL03411:Abcc5 APN 16 20399560 missense probably damaging 0.97
PIT4508001:Abcc5 UTSW 16 20357378 missense probably damaging 0.97
R0021:Abcc5 UTSW 16 20378661 nonsense probably null
R0021:Abcc5 UTSW 16 20378661 nonsense probably null
R0220:Abcc5 UTSW 16 20369102 missense probably benign
R0401:Abcc5 UTSW 16 20376558 missense probably benign 0.09
R0448:Abcc5 UTSW 16 20399937 missense probably damaging 1.00
R0477:Abcc5 UTSW 16 20368569 missense possibly damaging 0.51
R0477:Abcc5 UTSW 16 20398885 missense probably damaging 0.96
R0601:Abcc5 UTSW 16 20404559 splice site probably benign
R0648:Abcc5 UTSW 16 20365882 missense possibly damaging 0.90
R0709:Abcc5 UTSW 16 20376592 missense possibly damaging 0.91
R1144:Abcc5 UTSW 16 20422438 utr 5 prime probably benign
R1552:Abcc5 UTSW 16 20398867 missense probably damaging 0.99
R1625:Abcc5 UTSW 16 20365817 missense probably damaging 0.99
R1748:Abcc5 UTSW 16 20333588 missense probably benign 0.01
R1789:Abcc5 UTSW 16 20365951 missense probably damaging 1.00
R1801:Abcc5 UTSW 16 20338887 missense probably benign 0.43
R1909:Abcc5 UTSW 16 20376509 critical splice donor site probably null
R2046:Abcc5 UTSW 16 20399817 missense possibly damaging 0.90
R2203:Abcc5 UTSW 16 20405882 missense possibly damaging 0.91
R3031:Abcc5 UTSW 16 20375113 missense probably damaging 0.99
R3417:Abcc5 UTSW 16 20405552 splice site probably benign
R3708:Abcc5 UTSW 16 20372180 missense probably benign 0.30
R3731:Abcc5 UTSW 16 20398934 nonsense probably null
R3829:Abcc5 UTSW 16 20365865 missense probably benign 0.00
R3847:Abcc5 UTSW 16 20372156 missense probably benign 0.12
R3850:Abcc5 UTSW 16 20372156 missense probably benign 0.12
R3955:Abcc5 UTSW 16 20405543 missense probably damaging 0.97
R4072:Abcc5 UTSW 16 20333695 missense probably damaging 1.00
R4432:Abcc5 UTSW 16 20368187 intron probably null
R4433:Abcc5 UTSW 16 20368187 intron probably null
R4505:Abcc5 UTSW 16 20333695 missense probably damaging 1.00
R4506:Abcc5 UTSW 16 20333695 missense probably damaging 1.00
R4715:Abcc5 UTSW 16 20398876 missense probably damaging 1.00
R4739:Abcc5 UTSW 16 20399626 missense probably damaging 1.00
R4866:Abcc5 UTSW 16 20422432 start codon destroyed probably null 1.00
R4905:Abcc5 UTSW 16 20399928 missense probably damaging 1.00
R4907:Abcc5 UTSW 16 20376546 missense possibly damaging 0.86
R5088:Abcc5 UTSW 16 20376662 missense probably damaging 1.00
R5232:Abcc5 UTSW 16 20338922 missense probably damaging 0.96
R5559:Abcc5 UTSW 16 20338886 missense probably damaging 1.00
R5647:Abcc5 UTSW 16 20399847 missense probably damaging 1.00
R5861:Abcc5 UTSW 16 20399894 missense probably damaging 1.00
R6190:Abcc5 UTSW 16 20392779 missense probably benign 0.02
R6213:Abcc5 UTSW 16 20400012 missense probably damaging 1.00
R6511:Abcc5 UTSW 16 20376594 missense probably damaging 0.99
R6732:Abcc5 UTSW 16 20404684 missense probably benign 0.01
R6815:Abcc5 UTSW 16 20333630 missense probably damaging 1.00
R6913:Abcc5 UTSW 16 20378744 missense possibly damaging 0.73
R6945:Abcc5 UTSW 16 20400009 missense probably benign
X0022:Abcc5 UTSW 16 20392587 missense probably damaging 1.00
X0053:Abcc5 UTSW 16 20364042 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CACAAGACAACTTCTCAATCCCTTCGT -3'
(R):5'- CCAGACAGGCAGTGGTGTGGA -3'

Sequencing Primer
(F):5'- accattgagctacgctcc -3'
(R):5'- tgtttgtttgtttgtttgtttgtttg -3'
Posted On2013-05-23