Incidental Mutation 'R4898:Stard9'
ID375871
Institutional Source Beutler Lab
Gene Symbol Stard9
Ensembl Gene ENSMUSG00000033705
Gene NameSTART domain containing 9
SynonymsE230025N21Rik, Kif16a, 4831403C07Rik, N-3 kinesin
MMRRC Submission 042502-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.275) question?
Stock #R4898 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location120629121-120731895 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 120706419 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 4224 (R4224*)
Ref Sequence ENSEMBL: ENSMUSP00000136055 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000140843] [ENSMUST00000154193] [ENSMUST00000180041]
Predicted Effect probably benign
Transcript: ENSMUST00000070420
SMART Domains Protein: ENSMUSP00000070111
Gene: ENSMUSG00000033705

DomainStartEndE-ValueType
coiled coil region 97 138 N/A INTRINSIC
low complexity region 142 151 N/A INTRINSIC
low complexity region 157 174 N/A INTRINSIC
low complexity region 234 255 N/A INTRINSIC
Pfam:START 274 469 3.2e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140843
SMART Domains Protein: ENSMUSP00000117178
Gene: ENSMUSG00000033705

DomainStartEndE-ValueType
FHA 63 115 2.8e-4 SMART
coiled coil region 334 354 N/A INTRINSIC
low complexity region 573 584 N/A INTRINSIC
low complexity region 866 871 N/A INTRINSIC
low complexity region 1023 1035 N/A INTRINSIC
low complexity region 1234 1248 N/A INTRINSIC
low complexity region 1765 1775 N/A INTRINSIC
low complexity region 2546 2559 N/A INTRINSIC
low complexity region 2953 2963 N/A INTRINSIC
low complexity region 3269 3281 N/A INTRINSIC
low complexity region 3421 3435 N/A INTRINSIC
coiled coil region 3767 3808 N/A INTRINSIC
low complexity region 3812 3821 N/A INTRINSIC
low complexity region 3827 3844 N/A INTRINSIC
low complexity region 3904 3925 N/A INTRINSIC
SCOP:d1jssa_ 3946 4142 1e-28 SMART
Blast:START 3947 4143 1e-10 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000154193
AA Change: R448*
SMART Domains Protein: ENSMUSP00000116900
Gene: ENSMUSG00000033705
AA Change: R448*

DomainStartEndE-ValueType
low complexity region 63 77 N/A INTRINSIC
coiled coil region 409 450 N/A INTRINSIC
low complexity region 454 463 N/A INTRINSIC
low complexity region 469 486 N/A INTRINSIC
low complexity region 546 567 N/A INTRINSIC
SCOP:d1jssa_ 588 784 4e-29 SMART
Blast:START 589 785 6e-12 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000180041
AA Change: R4224*
SMART Domains Protein: ENSMUSP00000136055
Gene: ENSMUSG00000033705
AA Change: R4224*

DomainStartEndE-ValueType
KISc 1 392 3.31e-143 SMART
low complexity region 398 409 N/A INTRINSIC
FHA 481 533 2.8e-4 SMART
coiled coil region 752 772 N/A INTRINSIC
low complexity region 991 1002 N/A INTRINSIC
low complexity region 1284 1289 N/A INTRINSIC
low complexity region 1441 1453 N/A INTRINSIC
low complexity region 1652 1666 N/A INTRINSIC
low complexity region 2183 2193 N/A INTRINSIC
low complexity region 2964 2977 N/A INTRINSIC
low complexity region 3371 3381 N/A INTRINSIC
low complexity region 3687 3699 N/A INTRINSIC
low complexity region 3839 3853 N/A INTRINSIC
coiled coil region 4185 4226 N/A INTRINSIC
low complexity region 4230 4239 N/A INTRINSIC
low complexity region 4245 4262 N/A INTRINSIC
low complexity region 4322 4343 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 116 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 T C 7: 45,989,687 Y944C probably damaging Het
Acacb T C 5: 114,232,938 V1747A probably benign Het
Acad8 C T 9: 26,978,402 R332H probably damaging Het
Acrbp A C 6: 125,050,538 T50P probably damaging Het
Ahctf1 G T 1: 179,755,512 N1500K probably benign Het
Arfgef1 A G 1: 10,159,573 I1301T possibly damaging Het
Arhgef15 T C 11: 68,951,345 S478G probably benign Het
Armh1 T C 4: 117,237,780 D21G probably damaging Het
Atp13a4 A T 16: 29,408,961 L1045* probably null Het
Atp2a3 T A 11: 72,982,680 L793H probably damaging Het
B4galnt4 C A 7: 141,068,260 P563Q probably benign Het
BC027072 A G 17: 71,751,071 M537T probably damaging Het
Bcl2a1b A T 9: 89,199,660 K94* probably null Het
Bod1 T A 11: 31,666,853 Q136L possibly damaging Het
C2cd3 A G 7: 100,405,959 K443R probably damaging Het
Cadps A G 14: 12,411,588 V1250A possibly damaging Het
Car12 T A 9: 66,764,318 Y332* probably null Het
Ccdc186 A T 19: 56,802,000 probably null Het
Cdh6 T C 15: 13,034,688 T629A probably damaging Het
Cep112 T A 11: 108,506,645 D353E probably damaging Het
Cep152 T C 2: 125,586,381 S777G probably benign Het
Clec4b2 A C 6: 123,204,204 K183Q probably benign Het
Cngb3 T C 4: 19,395,926 Y323H probably benign Het
Cnp G T 11: 100,576,376 E48D probably benign Het
Ctrb1 T A 8: 111,687,151 I194F probably benign Het
Cyp2d11 T A 15: 82,391,023 D241V probably benign Het
D5Ertd579e T A 5: 36,614,941 E703D probably damaging Het
Dlg1 T C 16: 31,857,946 V731A probably damaging Het
Dlgap5 T C 14: 47,413,819 S86G probably benign Het
Dock3 A G 9: 106,930,067 F1354L probably damaging Het
Dock3 C A 9: 106,992,972 V638F possibly damaging Het
E130309D02Rik A G 5: 143,301,837 S438P probably benign Het
Eif3c A T 7: 126,557,454 M407K probably benign Het
Epha4 T A 1: 77,390,075 K578* probably null Het
Erc2 C T 14: 27,653,328 L168F probably damaging Het
Esyt2 A G 12: 116,342,088 I313V probably benign Het
Far1 T A 7: 113,568,225 Y506N probably damaging Het
Fbxw26 T A 9: 109,717,969 N463Y possibly damaging Het
Fgg A G 3: 83,008,540 D96G probably benign Het
Gfer A G 17: 24,695,300 S130P probably damaging Het
Gm8994 A T 6: 136,328,739 Q66L possibly damaging Het
Hdac10 A T 15: 89,128,447 M1K probably null Het
Hsd3b1 A T 3: 98,853,326 S110R probably benign Het
Itga6 T C 2: 71,838,373 L552P possibly damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lama2 TTTGCGCATT TTT 10: 27,043,643 probably null Het
Llgl1 C T 11: 60,709,568 P581L probably benign Het
Lrrc8a A G 2: 30,257,202 K676R probably benign Het
Lrrc8b A T 5: 105,480,214 Y142F probably benign Het
Lyz2 T A 10: 117,278,709 D105V possibly damaging Het
Mamdc4 T C 2: 25,570,023 D76G probably damaging Het
Map7d1 T C 4: 126,233,225 K731E unknown Het
Mgam A C 6: 40,643,054 I26L probably benign Het
Mmp13 A T 9: 7,272,953 E104D probably benign Het
Morc2a C T 11: 3,676,664 R241* probably null Het
Mtfmt C A 9: 65,452,104 H354N probably benign Het
Myh3 T C 11: 67,099,407 I1626T probably benign Het
Ndst1 A T 18: 60,691,987 V753D probably benign Het
Neurl4 A G 11: 69,903,171 D151G probably damaging Het
Nlrx1 T C 9: 44,256,897 S568G probably benign Het
Olfr1263 T C 2: 90,015,418 F163L probably damaging Het
Olfr1513 G C 14: 52,349,542 P168R probably damaging Het
Olfr315 T C 11: 58,778,306 Y60H possibly damaging Het
Olfr325 T G 11: 58,581,720 L292R probably damaging Het
Olfr593 A G 7: 103,212,540 I216V probably damaging Het
Olfr798 A T 10: 129,625,599 I154N probably benign Het
Olfr901 A T 9: 38,430,815 M178L probably benign Het
Osbpl7 A G 11: 97,060,150 I608V probably damaging Het
Pard3b T C 1: 61,768,000 I58T probably damaging Het
Pcdhga1 A C 18: 37,662,354 E137A possibly damaging Het
Pde6c G A 19: 38,150,624 V301I possibly damaging Het
Pdia5 G C 16: 35,410,416 N338K possibly damaging Het
Pex11g T C 8: 3,464,042 Y40C probably damaging Het
Plekhg3 A G 12: 76,564,125 Y183C probably damaging Het
Pole A C 5: 110,290,224 probably null Het
Ppfia1 A G 7: 144,491,576 L948P probably damaging Het
Prdm2 A T 4: 143,134,191 V843E probably damaging Het
Prss56 C A 1: 87,187,986 F527L probably damaging Het
Psmd11 T C 11: 80,438,320 L88P probably damaging Het
Ptx3 G C 3: 66,224,991 G311A probably damaging Het
Rars A T 11: 35,808,558 L636H probably damaging Het
Rnft2 A G 5: 118,237,442 S81P probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Rxra T A 2: 27,741,183 I142N probably damaging Het
Scin T C 12: 40,104,932 M221V probably benign Het
Sfmbt2 G A 2: 10,579,258 V809I possibly damaging Het
Sirt1 T A 10: 63,322,004 I505F probably benign Het
Six5 T C 7: 19,095,171 Y179H probably damaging Het
Slc12a4 A C 8: 105,944,609 M982R probably damaging Het
Slco4c1 T A 1: 96,837,512 L404F probably damaging Het
Smn1 T C 13: 100,132,423 L259P probably damaging Het
Sorl1 T G 9: 42,041,639 D702A probably damaging Het
Spta1 A G 1: 174,237,834 E1983G possibly damaging Het
Srsf1 T A 11: 88,049,962 probably null Het
Svs1 A G 6: 48,987,717 T220A possibly damaging Het
Sybu T G 15: 44,675,499 M383L probably benign Het
Tbx15 A C 3: 99,352,267 N485H possibly damaging Het
Tcerg1l A T 7: 138,218,057 F485I probably damaging Het
Tdrd7 C A 4: 46,005,616 T474N possibly damaging Het
Thada A T 17: 84,448,042 probably null Het
Tnik A T 3: 28,650,086 I1020F probably damaging Het
Tnxb A G 17: 34,695,592 D1884G possibly damaging Het
Tprn T C 2: 25,268,833 M623T probably damaging Het
Trdn T A 10: 33,474,417 Y661N probably damaging Het
Ttc41 T C 10: 86,776,192 S1110P possibly damaging Het
Ttc6 A C 12: 57,660,240 R644S probably benign Het
Ttyh1 A T 7: 4,133,736 M448L probably benign Het
Unc79 G T 12: 103,161,820 C2250F probably damaging Het
Ush2a A G 1: 188,626,608 I2110M probably benign Het
Uvssa G T 5: 33,413,913 E634* probably null Het
Vac14 A C 8: 110,645,808 T384P probably benign Het
Wdr11 A G 7: 129,633,721 E1169G probably benign Het
Zfp36l1 T A 12: 80,110,524 T28S probably benign Het
Zfp715 A T 7: 43,299,682 Y285N possibly damaging Het
Zfp91 A T 19: 12,770,060 D566E probably damaging Het
Zgrf1 G A 3: 127,602,436 V544M probably damaging Het
Other mutations in Stard9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01103:Stard9 APN 2 120701847 missense possibly damaging 0.52
IGL01122:Stard9 APN 2 120698479 missense possibly damaging 0.93
IGL01318:Stard9 APN 2 120698719 missense possibly damaging 0.56
IGL01371:Stard9 APN 2 120701368 missense probably benign 0.04
IGL01394:Stard9 APN 2 120706327 missense possibly damaging 0.78
IGL01531:Stard9 APN 2 120673604 missense possibly damaging 0.93
IGL01721:Stard9 APN 2 120703330 missense probably damaging 1.00
IGL01810:Stard9 APN 2 120699084 missense possibly damaging 0.95
IGL01829:Stard9 APN 2 120706446 missense possibly damaging 0.59
IGL01916:Stard9 APN 2 120668016 missense probably damaging 1.00
IGL02031:Stard9 APN 2 120702339 missense probably benign 0.27
IGL02081:Stard9 APN 2 120664910 missense probably damaging 0.98
IGL02558:Stard9 APN 2 120696907 missense possibly damaging 0.95
IGL02646:Stard9 APN 2 120698992 missense probably damaging 1.00
IGL02873:Stard9 APN 2 120713807 missense probably damaging 1.00
IGL03195:Stard9 APN 2 120705802 missense probably damaging 1.00
IGL03204:Stard9 APN 2 120705802 missense probably damaging 1.00
FR4737:Stard9 UTSW 2 120696085 small insertion probably benign
IGL03014:Stard9 UTSW 2 120702194 unclassified probably benign
R0027:Stard9 UTSW 2 120703501 missense probably benign
R0027:Stard9 UTSW 2 120703501 missense probably benign
R0038:Stard9 UTSW 2 120695832 missense probably benign
R0049:Stard9 UTSW 2 120699819 missense probably damaging 1.00
R0049:Stard9 UTSW 2 120699819 missense probably damaging 1.00
R0116:Stard9 UTSW 2 120634255 missense probably damaging 0.99
R0398:Stard9 UTSW 2 120696307 missense probably benign 0.03
R0479:Stard9 UTSW 2 120697596 missense probably damaging 1.00
R0556:Stard9 UTSW 2 120698923 missense probably benign 0.09
R0589:Stard9 UTSW 2 120698547 missense probably benign 0.00
R0609:Stard9 UTSW 2 120706306 missense probably damaging 1.00
R0611:Stard9 UTSW 2 120699257 missense probably benign 0.00
R0683:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R0751:Stard9 UTSW 2 120697485 missense probably benign 0.04
R0833:Stard9 UTSW 2 120696999 missense possibly damaging 0.86
R0836:Stard9 UTSW 2 120696999 missense possibly damaging 0.86
R0838:Stard9 UTSW 2 120700842 missense probably damaging 1.00
R0848:Stard9 UTSW 2 120695823 missense probably damaging 1.00
R0849:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R0961:Stard9 UTSW 2 120693439 missense probably benign 0.01
R0993:Stard9 UTSW 2 120705169 missense probably damaging 1.00
R1005:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1006:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1115:Stard9 UTSW 2 120692850 missense probably benign 0.05
R1163:Stard9 UTSW 2 120696213 missense possibly damaging 0.86
R1199:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1200:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1331:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1332:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1333:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1334:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1335:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1336:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1338:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1346:Stard9 UTSW 2 120713448 missense probably damaging 1.00
R1370:Stard9 UTSW 2 120697477 missense probably benign 0.11
R1384:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1401:Stard9 UTSW 2 120712847 splice site probably benign
R1416:Stard9 UTSW 2 120700972 missense probably benign 0.00
R1453:Stard9 UTSW 2 120666376 missense probably damaging 1.00
R1468:Stard9 UTSW 2 120703197 missense possibly damaging 0.90
R1468:Stard9 UTSW 2 120703197 missense possibly damaging 0.90
R1525:Stard9 UTSW 2 120702052 missense probably benign 0.09
R1538:Stard9 UTSW 2 120696711 missense probably benign 0.25
R1614:Stard9 UTSW 2 120697675 missense possibly damaging 0.95
R1654:Stard9 UTSW 2 120703722 missense probably benign 0.37
R1658:Stard9 UTSW 2 120701542 missense probably benign 0.02
R1686:Stard9 UTSW 2 120699492 missense probably benign 0.00
R1797:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1803:Stard9 UTSW 2 120701489 missense probably benign 0.24
R1806:Stard9 UTSW 2 120679453 splice site probably null
R1847:Stard9 UTSW 2 120698489 missense possibly damaging 0.51
R1853:Stard9 UTSW 2 120688751 missense probably damaging 1.00
R1892:Stard9 UTSW 2 120693708 missense probably benign 0.01
R1906:Stard9 UTSW 2 120696427 missense probably benign 0.00
R1907:Stard9 UTSW 2 120713812 missense probably damaging 1.00
R1930:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1933:Stard9 UTSW 2 120698656 missense possibly damaging 0.55
R1989:Stard9 UTSW 2 120701406 missense probably benign
R1999:Stard9 UTSW 2 120692868 missense probably damaging 0.99
R2004:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R2005:Stard9 UTSW 2 120664945 missense possibly damaging 0.90
R2005:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R2021:Stard9 UTSW 2 120704235 missense probably benign 0.05
R2025:Stard9 UTSW 2 120702398 missense probably benign 0.20
R2190:Stard9 UTSW 2 120714120 missense probably benign 0.22
R2204:Stard9 UTSW 2 120698531 frame shift probably null
R2422:Stard9 UTSW 2 120700284 missense probably benign 0.29
R3401:Stard9 UTSW 2 120703689 missense probably damaging 0.98
R3618:Stard9 UTSW 2 120699019 missense possibly damaging 0.49
R3619:Stard9 UTSW 2 120699019 missense possibly damaging 0.49
R3900:Stard9 UTSW 2 120713549 missense possibly damaging 0.93
R3943:Stard9 UTSW 2 120698229 missense probably benign 0.11
R4022:Stard9 UTSW 2 120704155 missense probably benign 0.05
R4223:Stard9 UTSW 2 120664991 missense possibly damaging 0.95
R4224:Stard9 UTSW 2 120664991 missense possibly damaging 0.95
R4225:Stard9 UTSW 2 120664991 missense possibly damaging 0.95
R4345:Stard9 UTSW 2 120701946 missense probably benign 0.43
R4382:Stard9 UTSW 2 120634222 missense probably damaging 1.00
R4453:Stard9 UTSW 2 120697791 missense probably benign
R4499:Stard9 UTSW 2 120700241 missense probably benign 0.05
R4524:Stard9 UTSW 2 120696445 missense probably damaging 1.00
R4671:Stard9 UTSW 2 120698640 missense probably damaging 0.98
R4701:Stard9 UTSW 2 120705713 missense possibly damaging 0.85
R4744:Stard9 UTSW 2 120696123 missense probably benign 0.01
R4822:Stard9 UTSW 2 120695941 missense possibly damaging 0.94
R4847:Stard9 UTSW 2 120703113 missense probably benign 0.18
R4863:Stard9 UTSW 2 120700860 missense probably benign 0.00
R5033:Stard9 UTSW 2 120693399 missense probably benign 0.00
R5087:Stard9 UTSW 2 120697019 nonsense probably null
R5157:Stard9 UTSW 2 120697861 missense probably benign
R5213:Stard9 UTSW 2 120699226 missense probably damaging 1.00
R5237:Stard9 UTSW 2 120699358 missense probably damaging 0.96
R5257:Stard9 UTSW 2 120699343 missense probably damaging 0.99
R5258:Stard9 UTSW 2 120699343 missense probably damaging 0.99
R5273:Stard9 UTSW 2 120705087 missense possibly damaging 0.94
R5286:Stard9 UTSW 2 120701947 missense probably benign 0.43
R5288:Stard9 UTSW 2 120700630 missense probably damaging 0.98
R5292:Stard9 UTSW 2 120699145 missense probably benign 0.17
R5328:Stard9 UTSW 2 120699230 missense probably damaging 1.00
R5385:Stard9 UTSW 2 120700630 missense probably damaging 0.98
R5386:Stard9 UTSW 2 120700630 missense probably damaging 0.98
R5393:Stard9 UTSW 2 120702906 missense possibly damaging 0.87
R5405:Stard9 UTSW 2 120693668 missense probably benign 0.17
R5685:Stard9 UTSW 2 120705322 missense probably damaging 1.00
R5749:Stard9 UTSW 2 120703786 missense probably damaging 1.00
R5780:Stard9 UTSW 2 120703396 missense probably benign 0.02
R5901:Stard9 UTSW 2 120701370 missense probably damaging 1.00
R5941:Stard9 UTSW 2 120713558 missense probably damaging 1.00
R5960:Stard9 UTSW 2 120699961 missense probably benign 0.05
R5966:Stard9 UTSW 2 120697099 missense probably damaging 1.00
R5967:Stard9 UTSW 2 120706894 missense probably damaging 0.99
R6012:Stard9 UTSW 2 120704586 missense probably damaging 1.00
R6019:Stard9 UTSW 2 120693715 frame shift probably null
R6020:Stard9 UTSW 2 120693715 frame shift probably null
R6036:Stard9 UTSW 2 120700075 missense probably benign 0.09
R6036:Stard9 UTSW 2 120700075 missense probably benign 0.09
R6090:Stard9 UTSW 2 120693654 missense probably damaging 0.99
R6192:Stard9 UTSW 2 120696760 missense probably damaging 0.99
R6228:Stard9 UTSW 2 120713750 missense probably damaging 1.00
R6235:Stard9 UTSW 2 120713546 missense probably damaging 1.00
R6280:Stard9 UTSW 2 120701127 missense probably benign
R6338:Stard9 UTSW 2 120697485 missense probably benign
R6344:Stard9 UTSW 2 120704320 missense probably benign 0.12
R6364:Stard9 UTSW 2 120713429 missense probably damaging 1.00
R6383:Stard9 UTSW 2 120666407 critical splice donor site probably null
R6644:Stard9 UTSW 2 120695772 missense probably benign 0.11
R6747:Stard9 UTSW 2 120698383 missense possibly damaging 0.62
R6833:Stard9 UTSW 2 120701259 missense probably damaging 1.00
R6836:Stard9 UTSW 2 120699843 missense probably benign 0.15
R6861:Stard9 UTSW 2 120705186 missense probably benign 0.09
R6872:Stard9 UTSW 2 120714068 nonsense probably null
R6875:Stard9 UTSW 2 120697436 missense probably benign 0.04
R6915:Stard9 UTSW 2 120702630 missense probably benign 0.00
R6934:Stard9 UTSW 2 120697695 missense probably benign 0.00
R6943:Stard9 UTSW 2 120702196 missense probably benign 0.29
R7009:Stard9 UTSW 2 120697191 missense probably benign 0.37
R7031:Stard9 UTSW 2 120700450 missense possibly damaging 0.61
R7132:Stard9 UTSW 2 120679378 nonsense probably null
R7151:Stard9 UTSW 2 120696142 missense not run
X0023:Stard9 UTSW 2 120702744 missense probably benign 0.00
X0023:Stard9 UTSW 2 120702963 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- ATGTGCTTGCCATGTTAGAAGG -3'
(R):5'- CCCCATGAGTGTAAAGGGAATG -3'

Sequencing Primer
(F):5'- CCATGTTAGAAGGTGTCTTTTCAC -3'
(R):5'- TGGGAGCCCAGCTTTGG -3'
Posted On2016-03-17