Incidental Mutation 'R0282:Gapvd1'
ID37593
Institutional Source Beutler Lab
Gene Symbol Gapvd1
Ensembl Gene ENSMUSG00000026867
Gene NameGTPase activating protein and VPS9 domains 1
Synonyms4432404J10Rik, 2010005B09Rik
MMRRC Submission 038504-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0282 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location34674594-34755232 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 34688960 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 654 (R654*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028224] [ENSMUST00000102800] [ENSMUST00000113099]
Predicted Effect probably null
Transcript: ENSMUST00000028224
AA Change: R1196*
SMART Domains Protein: ENSMUSP00000028224
Gene: ENSMUSG00000026867
AA Change: R1196*

DomainStartEndE-ValueType
Pfam:RasGAP 152 353 2.3e-36 PFAM
internal_repeat_1 626 655 3.27e-5 PROSPERO
low complexity region 664 678 N/A INTRINSIC
internal_repeat_1 686 717 3.27e-5 PROSPERO
low complexity region 875 890 N/A INTRINSIC
low complexity region 909 920 N/A INTRINSIC
low complexity region 923 933 N/A INTRINSIC
low complexity region 936 952 N/A INTRINSIC
low complexity region 972 982 N/A INTRINSIC
VPS9 1332 1437 1.08e-24 SMART
Predicted Effect probably null
Transcript: ENSMUST00000102800
AA Change: R1196*
SMART Domains Protein: ENSMUSP00000099864
Gene: ENSMUSG00000026867
AA Change: R1196*

DomainStartEndE-ValueType
Pfam:RasGAP 152 353 2.3e-36 PFAM
internal_repeat_1 626 655 3.27e-5 PROSPERO
low complexity region 664 678 N/A INTRINSIC
internal_repeat_1 686 717 3.27e-5 PROSPERO
low complexity region 875 890 N/A INTRINSIC
low complexity region 909 920 N/A INTRINSIC
low complexity region 923 933 N/A INTRINSIC
low complexity region 936 952 N/A INTRINSIC
low complexity region 972 982 N/A INTRINSIC
VPS9 1332 1437 1.08e-24 SMART
Predicted Effect probably null
Transcript: ENSMUST00000113099
AA Change: R1217*
SMART Domains Protein: ENSMUSP00000108723
Gene: ENSMUSG00000026867
AA Change: R1217*

DomainStartEndE-ValueType
Pfam:RasGAP 152 353 2.8e-37 PFAM
internal_repeat_1 647 676 3.6e-5 PROSPERO
low complexity region 685 699 N/A INTRINSIC
internal_repeat_1 707 738 3.6e-5 PROSPERO
low complexity region 896 911 N/A INTRINSIC
low complexity region 930 941 N/A INTRINSIC
low complexity region 944 954 N/A INTRINSIC
low complexity region 957 973 N/A INTRINSIC
low complexity region 993 1003 N/A INTRINSIC
VPS9 1353 1458 1.08e-24 SMART
Predicted Effect probably null
Transcript: ENSMUST00000113101
AA Change: R306*
SMART Domains Protein: ENSMUSP00000108725
Gene: ENSMUSG00000026867
AA Change: R306*

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
low complexity region 47 58 N/A INTRINSIC
low complexity region 61 71 N/A INTRINSIC
low complexity region 74 90 N/A INTRINSIC
VPS9 443 548 1.08e-24 SMART
Predicted Effect probably null
Transcript: ENSMUST00000113111
AA Change: R654*
SMART Domains Protein: ENSMUSP00000108735
Gene: ENSMUSG00000026867
AA Change: R654*

DomainStartEndE-ValueType
internal_repeat_1 85 114 3.65e-6 PROSPERO
low complexity region 123 137 N/A INTRINSIC
internal_repeat_1 145 176 3.65e-6 PROSPERO
low complexity region 334 349 N/A INTRINSIC
low complexity region 368 379 N/A INTRINSIC
low complexity region 382 392 N/A INTRINSIC
low complexity region 395 411 N/A INTRINSIC
low complexity region 431 441 N/A INTRINSIC
VPS9 791 896 1.08e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138203
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167251
Meta Mutation Damage Score 0.612 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.7%
Validation Efficiency 100% (72/72)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
1700123L14Rik T C 6: 96,164,816 T416A probably benign Het
Afap1l2 A G 19: 56,916,221 S549P possibly damaging Het
Alcam A T 16: 52,295,741 C157S probably damaging Het
Aldh1a1 T C 19: 20,629,049 probably benign Het
Ano8 G A 8: 71,480,614 probably benign Het
Atr T C 9: 95,862,798 V56A probably benign Het
Aurkc T A 7: 7,002,428 probably null Het
Bnip3 T C 7: 138,898,030 D76G probably damaging Het
Cbr1 A G 16: 93,610,134 E246G possibly damaging Het
Ccdc157 G T 11: 4,146,708 A449D probably damaging Het
Ces3b T A 8: 105,083,851 V26D probably benign Het
Colgalt2 G T 1: 152,508,561 A551S possibly damaging Het
Crk G T 11: 75,703,369 G261C probably damaging Het
Ctbp1 A G 5: 33,250,856 probably null Het
Ctnna1 G A 18: 35,244,122 V572I possibly damaging Het
D430041D05Rik T C 2: 104,201,244 Y1669C probably damaging Het
Dnah8 T C 17: 30,736,156 F2053S probably damaging Het
Dner G A 1: 84,405,965 T566M probably damaging Het
Dner A G 1: 84,445,380 probably benign Het
Edrf1 T C 7: 133,644,022 V223A probably benign Het
Fam169a A G 13: 97,097,715 probably benign Het
Fbxl3 G A 14: 103,095,225 H106Y probably damaging Het
Fiz1 A G 7: 5,009,201 V106A probably benign Het
Gm7589 G A 9: 59,146,005 noncoding transcript Het
Ifi202b A T 1: 173,977,360 S9T probably benign Het
Ipmk G C 10: 71,372,831 S149T probably benign Het
Irgm2 A G 11: 58,219,519 E24G probably benign Het
Itga2b A C 11: 102,460,846 V551G probably damaging Het
Itgad C T 7: 128,189,978 probably benign Het
Kcnh8 T A 17: 52,725,851 F55L probably damaging Het
Kdr G A 5: 75,950,100 probably benign Het
Krt35 T C 11: 100,095,747 Y147C probably damaging Het
Lamc1 A G 1: 153,255,312 F298L probably benign Het
Lrrk2 T C 15: 91,778,414 probably benign Het
Matn1 T C 4: 130,945,927 S69P probably damaging Het
Micall1 G T 15: 79,131,901 probably benign Het
Msto1 A G 3: 88,911,577 V257A possibly damaging Het
Mybpc3 G C 2: 91,124,024 probably benign Het
Mycn A G 12: 12,937,313 V361A probably benign Het
Myo10 A G 15: 25,793,167 T1277A probably damaging Het
Myo3a T C 2: 22,245,598 I92T probably benign Het
Olfr1199 G A 2: 88,756,456 T73I probably damaging Het
Olfr1510 A G 14: 52,410,263 V203A possibly damaging Het
Olfr267 A G 4: 58,785,344 I126T probably damaging Het
Olfr504 T A 7: 108,565,477 Q106L probably damaging Het
Otog C T 7: 46,277,493 T1222I possibly damaging Het
P4ha1 C T 10: 59,337,148 T23M probably damaging Het
Pld1 A T 3: 28,078,273 I537F probably benign Het
Plekhn1 A G 4: 156,228,323 probably benign Het
Pxdn C A 12: 29,984,440 S8* probably null Het
Rnf135 A T 11: 80,193,958 I186F probably damaging Het
Rock2 T C 12: 16,977,886 probably benign Het
Rph3a C A 5: 120,963,910 G88* probably null Het
Sarm1 G A 11: 78,474,980 Q740* probably null Het
Setd1b C A 5: 123,161,017 probably benign Het
Sidt1 A G 16: 44,281,886 S304P possibly damaging Het
Slc2a4 A T 11: 69,946,355 V85E probably damaging Het
Swi5 A G 2: 32,280,754 Y54H probably damaging Het
Sycp1 A G 3: 102,915,795 probably benign Het
Tarm1 T C 7: 3,497,490 Y87C probably damaging Het
Tmem67 G A 4: 12,087,930 T72M probably damaging Het
Tor1a A G 2: 30,967,725 Y44H possibly damaging Het
Ttll5 T C 12: 85,996,053 Y1128H probably benign Het
Usp40 G A 1: 87,980,958 probably benign Het
Vmn2r18 A T 5: 151,585,203 M152K probably benign Het
Xirp2 T A 2: 67,513,380 D1988E probably damaging Het
Zfp420 A G 7: 29,875,680 I442V probably benign Het
Zyx A G 6: 42,356,005 E363G probably damaging Het
Other mutations in Gapvd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:Gapvd1 APN 2 34699860 missense probably benign 0.00
IGL00985:Gapvd1 APN 2 34695563 missense probably damaging 0.99
IGL01133:Gapvd1 APN 2 34725398 missense probably damaging 0.98
IGL01347:Gapvd1 APN 2 34706696 critical splice donor site probably null
IGL01830:Gapvd1 APN 2 34688956 missense probably benign 0.44
IGL01865:Gapvd1 APN 2 34695503 missense probably null
IGL02009:Gapvd1 APN 2 34704191 missense probably damaging 1.00
IGL02014:Gapvd1 APN 2 34704191 missense probably damaging 1.00
IGL02189:Gapvd1 APN 2 34728544 missense probably damaging 1.00
IGL02418:Gapvd1 APN 2 34730518 missense probably benign 0.00
IGL02632:Gapvd1 APN 2 34684174 splice site probably benign
IGL02636:Gapvd1 APN 2 34725404 missense probably benign 0.01
IGL02643:Gapvd1 APN 2 34704180 missense probably damaging 1.00
IGL03271:Gapvd1 APN 2 34727207 unclassified probably benign
P0023:Gapvd1 UTSW 2 34706688 splice site probably benign
R0016:Gapvd1 UTSW 2 34699913 splice site probably benign
R0016:Gapvd1 UTSW 2 34699913 splice site probably benign
R0029:Gapvd1 UTSW 2 34678141 missense probably damaging 1.00
R0029:Gapvd1 UTSW 2 34678141 missense probably damaging 1.00
R0414:Gapvd1 UTSW 2 34693427 missense probably benign 0.14
R0443:Gapvd1 UTSW 2 34704621 intron probably benign
R0542:Gapvd1 UTSW 2 34725036 unclassified probably benign
R0570:Gapvd1 UTSW 2 34728540 missense probably damaging 1.00
R0840:Gapvd1 UTSW 2 34729113 missense probably benign 0.29
R0866:Gapvd1 UTSW 2 34709217 missense probably damaging 1.00
R0890:Gapvd1 UTSW 2 34712317 missense probably damaging 1.00
R0926:Gapvd1 UTSW 2 34712325 missense probably damaging 1.00
R0970:Gapvd1 UTSW 2 34730613 unclassified probably null
R1168:Gapvd1 UTSW 2 34704469 missense probably damaging 1.00
R1391:Gapvd1 UTSW 2 34706802 missense probably damaging 1.00
R1577:Gapvd1 UTSW 2 34709228 missense probably damaging 1.00
R1585:Gapvd1 UTSW 2 34712195 missense possibly damaging 0.93
R1669:Gapvd1 UTSW 2 34730682 critical splice acceptor site probably null
R1677:Gapvd1 UTSW 2 34700761 critical splice donor site probably null
R1812:Gapvd1 UTSW 2 34725064 nonsense probably null
R1874:Gapvd1 UTSW 2 34706021 missense probably damaging 1.00
R1878:Gapvd1 UTSW 2 34725200 missense probably benign 0.00
R1974:Gapvd1 UTSW 2 34700841 missense probably damaging 0.99
R2111:Gapvd1 UTSW 2 34684317 missense probably benign 0.08
R2921:Gapvd1 UTSW 2 34688863 missense probably damaging 0.97
R2923:Gapvd1 UTSW 2 34688863 missense probably damaging 0.97
R3846:Gapvd1 UTSW 2 34729072 nonsense probably null
R3894:Gapvd1 UTSW 2 34728476 missense probably benign 0.23
R4405:Gapvd1 UTSW 2 34728735 missense probably damaging 1.00
R4605:Gapvd1 UTSW 2 34728537 missense probably damaging 1.00
R4770:Gapvd1 UTSW 2 34691181 missense probably damaging 0.98
R4935:Gapvd1 UTSW 2 34704492 nonsense probably null
R5218:Gapvd1 UTSW 2 34728476 missense probably benign 0.23
R5490:Gapvd1 UTSW 2 34693433 missense probably benign 0.23
R5571:Gapvd1 UTSW 2 34715253 missense probably damaging 1.00
R5588:Gapvd1 UTSW 2 34709154 missense probably damaging 1.00
R5933:Gapvd1 UTSW 2 34684291 missense probably benign 0.27
R6117:Gapvd1 UTSW 2 34690459 splice site probably null
R6661:Gapvd1 UTSW 2 34728438 missense probably damaging 1.00
R6857:Gapvd1 UTSW 2 34728377 missense probably damaging 1.00
R6950:Gapvd1 UTSW 2 34684245 missense probably benign 0.04
R7009:Gapvd1 UTSW 2 34700817 missense probably damaging 1.00
R7125:Gapvd1 UTSW 2 34695600 missense probably benign
R7154:Gapvd1 UTSW 2 34725063 missense probably damaging 1.00
R7316:Gapvd1 UTSW 2 34704669 missense probably damaging 1.00
R7358:Gapvd1 UTSW 2 34690461 critical splice donor site probably null
R7363:Gapvd1 UTSW 2 34712195 missense probably benign 0.01
R7371:Gapvd1 UTSW 2 34717373 missense probably benign
R7418:Gapvd1 UTSW 2 34725118 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- GGCTGGCAGGGTAATTTAAGGAACT -3'
(R):5'- GCTTATCTACAGCCTCTCGTGCCAA -3'

Sequencing Primer
(F):5'- TTAAGGAACTGCTGTAAGACATGC -3'
(R):5'- GCCAACTAGTAAAACCAAAGTCTGTG -3'
Posted On2013-05-23