Incidental Mutation 'R4898:Sybu'
ID375962
Institutional Source Beutler Lab
Gene Symbol Sybu
Ensembl Gene ENSMUSG00000022340
Gene Namesyntabulin (syntaxin-interacting)
SynonymsA830027B17Rik, Golsyn/Syntabulin, 5730410E15Rik
MMRRC Submission 042502-MU
Accession Numbers

Genbank: NM_176998 ; MGI: 2442392

Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R4898 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location44671856-44788063 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 44675499 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 383 (M383L)
Ref Sequence ENSEMBL: ENSMUSP00000087511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090057] [ENSMUST00000110267] [ENSMUST00000110269] [ENSMUST00000226214] [ENSMUST00000227305] [ENSMUST00000228057]
Predicted Effect probably benign
Transcript: ENSMUST00000090057
AA Change: M383L

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000087511
Gene: ENSMUSG00000022340
AA Change: M383L

DomainStartEndE-ValueType
low complexity region 51 61 N/A INTRINSIC
low complexity region 112 120 N/A INTRINSIC
low complexity region 148 163 N/A INTRINSIC
low complexity region 174 205 N/A INTRINSIC
low complexity region 264 275 N/A INTRINSIC
low complexity region 276 290 N/A INTRINSIC
low complexity region 320 331 N/A INTRINSIC
Pfam:Syntaphilin 343 638 3.5e-142 PFAM
low complexity region 738 755 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110267
AA Change: M255L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000105896
Gene: ENSMUSG00000022340
AA Change: M255L

DomainStartEndE-ValueType
low complexity region 20 35 N/A INTRINSIC
low complexity region 46 77 N/A INTRINSIC
low complexity region 136 147 N/A INTRINSIC
low complexity region 148 162 N/A INTRINSIC
low complexity region 192 203 N/A INTRINSIC
Pfam:Syntaphilin 214 511 5.8e-140 PFAM
low complexity region 610 627 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110269
AA Change: M183L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000105898
Gene: ENSMUSG00000022340
AA Change: M183L

DomainStartEndE-ValueType
low complexity region 64 75 N/A INTRINSIC
low complexity region 76 90 N/A INTRINSIC
low complexity region 120 131 N/A INTRINSIC
Pfam:Syntaphilin 142 439 4.4e-140 PFAM
low complexity region 538 555 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000226214
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226825
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227081
Predicted Effect probably benign
Transcript: ENSMUST00000227305
AA Change: M254L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000228057
AA Change: M255L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Syntabulin/GOLSYN is part of a kinesin motor-adaptor complex that is critical for the anterograde axonal transport of active zone components and contributes to activity-dependent presynaptic assembly during neuronal development (Cai et al., 2007 [PubMed 17611281]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 116 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 T C 7: 45,989,687 Y944C probably damaging Het
Acacb T C 5: 114,232,938 V1747A probably benign Het
Acad8 C T 9: 26,978,402 R332H probably damaging Het
Acrbp A C 6: 125,050,538 T50P probably damaging Het
Ahctf1 G T 1: 179,755,512 N1500K probably benign Het
Arfgef1 A G 1: 10,159,573 I1301T possibly damaging Het
Arhgef15 T C 11: 68,951,345 S478G probably benign Het
Armh1 T C 4: 117,237,780 D21G probably damaging Het
Atp13a4 A T 16: 29,408,961 L1045* probably null Het
Atp2a3 T A 11: 72,982,680 L793H probably damaging Het
B4galnt4 C A 7: 141,068,260 P563Q probably benign Het
BC027072 A G 17: 71,751,071 M537T probably damaging Het
Bcl2a1b A T 9: 89,199,660 K94* probably null Het
Bod1 T A 11: 31,666,853 Q136L possibly damaging Het
C2cd3 A G 7: 100,405,959 K443R probably damaging Het
Cadps A G 14: 12,411,588 V1250A possibly damaging Het
Car12 T A 9: 66,764,318 Y332* probably null Het
Ccdc186 A T 19: 56,802,000 probably null Het
Cdh6 T C 15: 13,034,688 T629A probably damaging Het
Cep112 T A 11: 108,506,645 D353E probably damaging Het
Cep152 T C 2: 125,586,381 S777G probably benign Het
Clec4b2 A C 6: 123,204,204 K183Q probably benign Het
Cngb3 T C 4: 19,395,926 Y323H probably benign Het
Cnp G T 11: 100,576,376 E48D probably benign Het
Ctrb1 T A 8: 111,687,151 I194F probably benign Het
Cyp2d11 T A 15: 82,391,023 D241V probably benign Het
D5Ertd579e T A 5: 36,614,941 E703D probably damaging Het
Dlg1 T C 16: 31,857,946 V731A probably damaging Het
Dlgap5 T C 14: 47,413,819 S86G probably benign Het
Dock3 A G 9: 106,930,067 F1354L probably damaging Het
Dock3 C A 9: 106,992,972 V638F possibly damaging Het
E130309D02Rik A G 5: 143,301,837 S438P probably benign Het
Eif3c A T 7: 126,557,454 M407K probably benign Het
Epha4 T A 1: 77,390,075 K578* probably null Het
Erc2 C T 14: 27,653,328 L168F probably damaging Het
Esyt2 A G 12: 116,342,088 I313V probably benign Het
Far1 T A 7: 113,568,225 Y506N probably damaging Het
Fbxw26 T A 9: 109,717,969 N463Y possibly damaging Het
Fgg A G 3: 83,008,540 D96G probably benign Het
Gfer A G 17: 24,695,300 S130P probably damaging Het
Gm8994 A T 6: 136,328,739 Q66L possibly damaging Het
Hdac10 A T 15: 89,128,447 M1K probably null Het
Hsd3b1 A T 3: 98,853,326 S110R probably benign Het
Itga6 T C 2: 71,838,373 L552P possibly damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lama2 TTTGCGCATT TTT 10: 27,043,643 probably null Het
Llgl1 C T 11: 60,709,568 P581L probably benign Het
Lrrc8a A G 2: 30,257,202 K676R probably benign Het
Lrrc8b A T 5: 105,480,214 Y142F probably benign Het
Lyz2 T A 10: 117,278,709 D105V possibly damaging Het
Mamdc4 T C 2: 25,570,023 D76G probably damaging Het
Map7d1 T C 4: 126,233,225 K731E unknown Het
Mgam A C 6: 40,643,054 I26L probably benign Het
Mmp13 A T 9: 7,272,953 E104D probably benign Het
Morc2a C T 11: 3,676,664 R241* probably null Het
Mtfmt C A 9: 65,452,104 H354N probably benign Het
Myh3 T C 11: 67,099,407 I1626T probably benign Het
Ndst1 A T 18: 60,691,987 V753D probably benign Het
Neurl4 A G 11: 69,903,171 D151G probably damaging Het
Nlrx1 T C 9: 44,256,897 S568G probably benign Het
Olfr1263 T C 2: 90,015,418 F163L probably damaging Het
Olfr1513 G C 14: 52,349,542 P168R probably damaging Het
Olfr315 T C 11: 58,778,306 Y60H possibly damaging Het
Olfr325 T G 11: 58,581,720 L292R probably damaging Het
Olfr593 A G 7: 103,212,540 I216V probably damaging Het
Olfr798 A T 10: 129,625,599 I154N probably benign Het
Olfr901 A T 9: 38,430,815 M178L probably benign Het
Osbpl7 A G 11: 97,060,150 I608V probably damaging Het
Pard3b T C 1: 61,768,000 I58T probably damaging Het
Pcdhga1 A C 18: 37,662,354 E137A possibly damaging Het
Pde6c G A 19: 38,150,624 V301I possibly damaging Het
Pdia5 G C 16: 35,410,416 N338K possibly damaging Het
Pex11g T C 8: 3,464,042 Y40C probably damaging Het
Plekhg3 A G 12: 76,564,125 Y183C probably damaging Het
Pole A C 5: 110,290,224 probably null Het
Ppfia1 A G 7: 144,491,576 L948P probably damaging Het
Prdm2 A T 4: 143,134,191 V843E probably damaging Het
Prss56 C A 1: 87,187,986 F527L probably damaging Het
Psmd11 T C 11: 80,438,320 L88P probably damaging Het
Ptx3 G C 3: 66,224,991 G311A probably damaging Het
Rars A T 11: 35,808,558 L636H probably damaging Het
Rnft2 A G 5: 118,237,442 S81P probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Rxra T A 2: 27,741,183 I142N probably damaging Het
Scin T C 12: 40,104,932 M221V probably benign Het
Sfmbt2 G A 2: 10,579,258 V809I possibly damaging Het
Sirt1 T A 10: 63,322,004 I505F probably benign Het
Six5 T C 7: 19,095,171 Y179H probably damaging Het
Slc12a4 A C 8: 105,944,609 M982R probably damaging Het
Slco4c1 T A 1: 96,837,512 L404F probably damaging Het
Smn1 T C 13: 100,132,423 L259P probably damaging Het
Sorl1 T G 9: 42,041,639 D702A probably damaging Het
Spta1 A G 1: 174,237,834 E1983G possibly damaging Het
Srsf1 T A 11: 88,049,962 probably null Het
Stard9 C T 2: 120,706,419 R4224* probably null Het
Svs1 A G 6: 48,987,717 T220A possibly damaging Het
Tbx15 A C 3: 99,352,267 N485H possibly damaging Het
Tcerg1l A T 7: 138,218,057 F485I probably damaging Het
Tdrd7 C A 4: 46,005,616 T474N possibly damaging Het
Thada A T 17: 84,448,042 probably null Het
Tnik A T 3: 28,650,086 I1020F probably damaging Het
Tnxb A G 17: 34,695,592 D1884G possibly damaging Het
Tprn T C 2: 25,268,833 M623T probably damaging Het
Trdn T A 10: 33,474,417 Y661N probably damaging Het
Ttc41 T C 10: 86,776,192 S1110P possibly damaging Het
Ttc6 A C 12: 57,660,240 R644S probably benign Het
Ttyh1 A T 7: 4,133,736 M448L probably benign Het
Unc79 G T 12: 103,161,820 C2250F probably damaging Het
Ush2a A G 1: 188,626,608 I2110M probably benign Het
Uvssa G T 5: 33,413,913 E634* probably null Het
Vac14 A C 8: 110,645,808 T384P probably benign Het
Wdr11 A G 7: 129,633,721 E1169G probably benign Het
Zfp36l1 T A 12: 80,110,524 T28S probably benign Het
Zfp715 A T 7: 43,299,682 Y285N possibly damaging Het
Zfp91 A T 19: 12,770,060 D566E probably damaging Het
Zgrf1 G A 3: 127,602,436 V544M probably damaging Het
Other mutations in Sybu
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01453:Sybu APN 15 44672805 missense probably damaging 1.00
IGL02211:Sybu APN 15 44673466 missense probably damaging 1.00
IGL02303:Sybu APN 15 44673223 missense probably benign 0.03
E7848:Sybu UTSW 15 44673422 missense probably benign 0.32
R0015:Sybu UTSW 15 44673500 missense probably damaging 0.99
R0015:Sybu UTSW 15 44673500 missense probably damaging 0.99
R0064:Sybu UTSW 15 44672993 missense probably benign 0.00
R0064:Sybu UTSW 15 44672993 missense probably benign 0.00
R0413:Sybu UTSW 15 44673272 missense probably damaging 1.00
R0650:Sybu UTSW 15 44673268 missense probably benign 0.08
R1147:Sybu UTSW 15 44746255 missense probably damaging 1.00
R1147:Sybu UTSW 15 44746255 missense probably damaging 1.00
R1307:Sybu UTSW 15 44675390 missense probably damaging 1.00
R1568:Sybu UTSW 15 44718832 nonsense probably null
R2112:Sybu UTSW 15 44673335 missense probably benign 0.06
R2967:Sybu UTSW 15 44746356 missense probably damaging 1.00
R3120:Sybu UTSW 15 44672959 missense possibly damaging 0.88
R3429:Sybu UTSW 15 44746458 missense probably damaging 0.98
R3508:Sybu UTSW 15 44673082 missense probably damaging 1.00
R3720:Sybu UTSW 15 44672632 missense possibly damaging 0.89
R4080:Sybu UTSW 15 44718943 missense probably damaging 1.00
R4975:Sybu UTSW 15 44677667 missense probably damaging 1.00
R5066:Sybu UTSW 15 44677644 missense probably damaging 1.00
R5783:Sybu UTSW 15 44746414 missense probably damaging 0.96
R5913:Sybu UTSW 15 44787621 missense probably damaging 1.00
R6977:Sybu UTSW 15 44677695 missense probably benign 0.00
R7044:Sybu UTSW 15 44677695 missense possibly damaging 0.79
R7139:Sybu UTSW 15 44677714 missense possibly damaging 0.93
R7328:Sybu UTSW 15 44787794 missense not run
Predicted Primers PCR Primer
(F):5'- AATTGTGCTAAGCCTCCTGGTG -3'
(R):5'- TTAATCCCCTCAGAAAAGCTCAATG -3'

Sequencing Primer
(F):5'- CTCCTGGTGTGGGGAATCC -3'
(R):5'- CCAGAGGGCTTAGGGTTCAATTCC -3'
Posted On2016-03-17