Incidental Mutation 'R4899:AI481877'
ID375995
Institutional Source Beutler Lab
Gene Symbol AI481877
Ensembl Gene ENSMUSG00000038598
Gene Nameexpressed sequence AI481877
SynonymsLOC242489, Gm426
MMRRC Submission 042503-MU
Accession Numbers

Genbank: XM_001476641.2; Ensembl: ENSMUST00000107547

Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock #R4899 (G1)
Quality Score167
Status Not validated
Chromosome4
Chromosomal Location59043753-59138983 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59062640 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 872 (Y872C)
Ref Sequence ENSEMBL: ENSMUSP00000103171 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107547]
Predicted Effect probably damaging
Transcript: ENSMUST00000107547
AA Change: Y872C

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103171
Gene: ENSMUSG00000038598
AA Change: Y872C

DomainStartEndE-ValueType
low complexity region 246 264 N/A INTRINSIC
low complexity region 543 560 N/A INTRINSIC
low complexity region 908 917 N/A INTRINSIC
low complexity region 1189 1201 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency
Allele List at MGI

All alleles(6) : Targeted, other(1) Gene trapped(5)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010005H15Rik A T 16: 36,257,365 Y96F possibly damaging Het
9230110C19Rik A T 9: 8,022,493 S243T possibly damaging Het
Abhd18 C G 3: 40,905,869 probably null Het
Adra2c A T 5: 35,280,361 Y159F probably damaging Het
Alkal2 T A 12: 30,884,973 S64T probably benign Het
Apbb1ip T C 2: 22,823,349 V72A unknown Het
Atp13a5 A G 16: 29,378,500 L13P probably damaging Het
Azin2 G A 4: 128,934,653 P254S probably benign Het
Bmpr1b T C 3: 141,840,683 R481G probably damaging Het
Cacna2d4 G A 6: 119,268,196 W288* probably null Het
Cass4 A G 2: 172,427,869 T626A probably benign Het
Cep112 T A 11: 108,606,284 D683E probably damaging Het
Chat G T 14: 32,448,977 S188R possibly damaging Het
Cit A G 5: 115,863,028 Y162C possibly damaging Het
Clca3a1 T A 3: 144,737,961 Y676F probably damaging Het
Clec2h A G 6: 128,675,824 N185D probably benign Het
Cnbd2 G T 2: 156,339,221 V192F probably benign Het
Col6a3 C A 1: 90,802,427 G1112V probably damaging Het
Cyp3a25 A G 5: 145,977,671 F483S possibly damaging Het
Dscam T C 16: 96,683,818 E1103G probably benign Het
Dync2h1 G A 9: 7,131,921 Q1629* probably null Het
E330014E10Rik T C 5: 95,801,727 V111A probably benign Het
Enpp6 A G 8: 46,987,083 Y38C probably damaging Het
Epg5 T A 18: 77,985,057 L1271Q probably damaging Het
Fam47e G A 5: 92,574,669 V75I probably benign Het
Fat3 T C 9: 15,969,799 D3259G probably damaging Het
Fbxw28 T C 9: 109,330,853 D211G probably damaging Het
Flnc A G 6: 29,446,843 N990D probably benign Het
Frat1 T G 19: 41,830,322 L52R probably damaging Het
Ftmt C G 18: 52,331,586 probably benign Het
H2-M1 C T 17: 36,671,220 G163D probably benign Het
Hapln1 A G 13: 89,601,650 K105E possibly damaging Het
Igkv17-127 G T 6: 67,861,397 A31S probably benign Het
Il6st T C 13: 112,501,161 L628P probably damaging Het
Kcnj6 A G 16: 94,832,613 I213T probably damaging Het
Kidins220 T C 12: 25,013,443 probably null Het
Lama2 TTTGCGCATT TTT 10: 27,043,643 probably null Het
Llgl1 C T 11: 60,709,568 P581L probably benign Het
Marc2 A T 1: 184,845,624 I65N probably damaging Het
Mertk C A 2: 128,783,925 P660Q probably damaging Het
Mkl1 A G 15: 81,018,386 Y241H probably damaging Het
Napepld A G 5: 21,683,440 Y4H probably benign Het
Ncam1 T A 9: 49,545,251 probably null Het
Nuak2 A T 1: 132,324,986 K93* probably null Het
Oat A T 7: 132,564,222 D211E probably benign Het
Olfr1214 A C 2: 88,988,110 L31V probably null Het
Olfr1355 A T 10: 78,879,207 S12C probably benign Het
Olfr171 G A 16: 19,624,200 A300V probably benign Het
Olfr348 A G 2: 36,786,798 Q91R probably benign Het
Olfr64 A G 7: 103,893,465 I90T possibly damaging Het
Pde4dip C A 3: 97,709,558 K1789N probably damaging Het
Piezo2 T C 18: 63,078,791 I1322V possibly damaging Het
Pih1d1 A G 7: 45,154,527 probably benign Het
Plekhd1 T C 12: 80,722,327 S454P probably damaging Het
Polr2h G A 16: 20,720,553 V89M probably damaging Het
Pptc7 G A 5: 122,284,717 G17S possibly damaging Het
Ptpra T C 2: 130,544,436 V602A probably damaging Het
Rnf123 C T 9: 108,063,680 R654H probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Samsn1 A G 16: 75,879,103 S135P probably damaging Het
Sgsm3 A G 15: 81,006,779 N147S probably benign Het
Slc22a29 T C 19: 8,161,569 T510A probably benign Het
Smc4 T A 3: 69,031,811 H978Q probably damaging Het
Sox7 G A 14: 63,948,478 R321H probably damaging Het
Spred3 T C 7: 29,161,833 D307G probably damaging Het
Syne2 T A 12: 75,854,101 D11E probably benign Het
Tob1 ACAGCAGCAGCAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCAGCAGCAGCA 11: 94,214,452 probably benign Het
Top2b A T 14: 16,387,313 I134F probably damaging Het
Tspan1 T A 4: 116,163,366 R206* probably null Het
Ttc3 A T 16: 94,429,455 N837I probably damaging Het
Vmn1r36 T C 6: 66,716,565 T72A possibly damaging Het
Vmn2r10 A G 5: 109,003,458 S97P probably damaging Het
Zfp2 T A 11: 50,900,014 I401F probably damaging Het
Zfp629 T C 7: 127,611,018 T540A possibly damaging Het
Zfr G A 15: 12,166,145 V834I probably benign Het
Other mutations in AI481877
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:AI481877 APN 4 59086961 missense probably benign
IGL00574:AI481877 APN 4 59094201 missense possibly damaging 0.66
IGL01333:AI481877 APN 4 59047870 missense possibly damaging 0.66
IGL02282:AI481877 APN 4 59111114 missense unknown
IGL02418:AI481877 APN 4 59049075 splice site probably benign
IGL02621:AI481877 APN 4 59062668 missense probably damaging 0.97
IGL03028:AI481877 APN 4 59094274 missense possibly damaging 0.66
IGL03112:AI481877 APN 4 59049355 missense probably benign 0.27
IGL03137:AI481877 APN 4 59094162 missense probably benign 0.27
IGL03220:AI481877 APN 4 59082378 nonsense probably null
IGL03386:AI481877 APN 4 59069315 missense possibly damaging 0.66
1mM(1):AI481877 UTSW 4 59048024 nonsense probably null
R0071:AI481877 UTSW 4 59059643 missense possibly damaging 0.92
R0071:AI481877 UTSW 4 59059643 missense possibly damaging 0.92
R0194:AI481877 UTSW 4 59066534 splice site probably benign
R0366:AI481877 UTSW 4 59099410 missense probably benign 0.09
R0680:AI481877 UTSW 4 59043967 missense probably benign 0.00
R1419:AI481877 UTSW 4 59064457 missense possibly damaging 0.66
R1599:AI481877 UTSW 4 59072349 missense possibly damaging 0.82
R1699:AI481877 UTSW 4 59113926 missense unknown
R1799:AI481877 UTSW 4 59099383 missense possibly damaging 0.92
R1832:AI481877 UTSW 4 59066441 missense probably benign 0.05
R1870:AI481877 UTSW 4 59054142 splice site probably benign
R2076:AI481877 UTSW 4 59082410 missense possibly damaging 0.46
R2170:AI481877 UTSW 4 59069215 missense possibly damaging 0.92
R2870:AI481877 UTSW 4 59093850 missense probably damaging 0.97
R2870:AI481877 UTSW 4 59093850 missense probably damaging 0.97
R2871:AI481877 UTSW 4 59093850 missense probably damaging 0.97
R2871:AI481877 UTSW 4 59093850 missense probably damaging 0.97
R2872:AI481877 UTSW 4 59093850 missense probably damaging 0.97
R2872:AI481877 UTSW 4 59093850 missense probably damaging 0.97
R2873:AI481877 UTSW 4 59093850 missense probably damaging 0.97
R3026:AI481877 UTSW 4 59062656 missense possibly damaging 0.83
R3079:AI481877 UTSW 4 59047848 missense possibly damaging 0.82
R3853:AI481877 UTSW 4 59047390 missense possibly damaging 0.66
R3914:AI481877 UTSW 4 59094201 missense possibly damaging 0.66
R4006:AI481877 UTSW 4 59076500 missense possibly damaging 0.53
R4364:AI481877 UTSW 4 59082294 missense possibly damaging 0.92
R4387:AI481877 UTSW 4 59060915 missense possibly damaging 0.66
R4454:AI481877 UTSW 4 59092383 missense possibly damaging 0.90
R4811:AI481877 UTSW 4 59082404 missense probably benign 0.19
R4853:AI481877 UTSW 4 59072345 missense possibly damaging 0.66
R5090:AI481877 UTSW 4 59111108 missense unknown
R5169:AI481877 UTSW 4 59059618 missense possibly damaging 0.66
R5297:AI481877 UTSW 4 59047543 missense probably benign
R5400:AI481877 UTSW 4 59082432 missense possibly damaging 0.83
R5419:AI481877 UTSW 4 59049017 missense probably benign 0.04
R5668:AI481877 UTSW 4 59047399 missense probably benign
R5770:AI481877 UTSW 4 59092466 missense probably benign 0.00
R5783:AI481877 UTSW 4 59076239 nonsense probably null
R5929:AI481877 UTSW 4 59092497 nonsense probably null
R6209:AI481877 UTSW 4 59043869 makesense probably null
R6230:AI481877 UTSW 4 59099345 missense probably benign
R6233:AI481877 UTSW 4 59076245 missense possibly damaging 0.92
R6351:AI481877 UTSW 4 59069317 missense probably benign 0.00
R6785:AI481877 UTSW 4 59049066 missense probably benign 0.01
R6884:AI481877 UTSW 4 59059652 missense possibly damaging 0.83
R7355:AI481877 UTSW 4 59076155 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGGTGCATGTTAAAGAAGTTACAC -3'
(R):5'- TGTTTTCCAGTTGAGGCCGC -3'

Sequencing Primer
(F):5'- CTCTATGAATAGCAATCGGAACAAAG -3'
(R):5'- CACAGGTCAGGCTAGCACAG -3'
Posted On2016-03-17