Incidental Mutation 'R4899:Mkl1'
ID376039
Institutional Source Beutler Lab
Gene Symbol Mkl1
Ensembl Gene ENSMUSG00000042292
Gene NameMKL (megakaryoblastic leukemia)/myocardin-like 1
SynonymsMal, MRTF-A, Bsac
MMRRC Submission 042503-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.508) question?
Stock #R4899 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location81012281-81190757 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 81018386 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 241 (Y241H)
Ref Sequence ENSEMBL: ENSMUSP00000117745 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109579] [ENSMUST00000131235] [ENSMUST00000134469] [ENSMUST00000135047] [ENSMUST00000149582]
Predicted Effect probably damaging
Transcript: ENSMUST00000109579
AA Change: Y276H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105207
Gene: ENSMUSG00000042292
AA Change: Y276H

DomainStartEndE-ValueType
RPEL 15 40 2.17e-7 SMART
RPEL 59 84 1.36e-8 SMART
RPEL 103 128 1.03e-8 SMART
low complexity region 146 159 N/A INTRINSIC
low complexity region 209 228 N/A INTRINSIC
low complexity region 259 272 N/A INTRINSIC
low complexity region 298 320 N/A INTRINSIC
low complexity region 340 365 N/A INTRINSIC
SAP 385 419 4.98e-10 SMART
low complexity region 424 433 N/A INTRINSIC
low complexity region 483 496 N/A INTRINSIC
coiled coil region 558 600 N/A INTRINSIC
low complexity region 670 679 N/A INTRINSIC
low complexity region 714 735 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000131235
AA Change: Y191H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120116
Gene: ENSMUSG00000042292
AA Change: Y191H

DomainStartEndE-ValueType
RPEL 24 49 1.36e-8 SMART
RPEL 68 93 1.03e-8 SMART
low complexity region 111 124 N/A INTRINSIC
low complexity region 174 187 N/A INTRINSIC
low complexity region 213 235 N/A INTRINSIC
low complexity region 255 280 N/A INTRINSIC
SAP 300 334 4.98e-10 SMART
low complexity region 339 348 N/A INTRINSIC
low complexity region 398 411 N/A INTRINSIC
coiled coil region 473 515 N/A INTRINSIC
low complexity region 585 594 N/A INTRINSIC
low complexity region 629 650 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000134469
AA Change: Y241H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119530
Gene: ENSMUSG00000042292
AA Change: Y241H

DomainStartEndE-ValueType
RPEL 24 49 1.36e-8 SMART
RPEL 68 93 1.03e-8 SMART
low complexity region 111 124 N/A INTRINSIC
low complexity region 174 193 N/A INTRINSIC
low complexity region 224 237 N/A INTRINSIC
low complexity region 263 285 N/A INTRINSIC
low complexity region 305 330 N/A INTRINSIC
SAP 350 384 4.98e-10 SMART
low complexity region 389 398 N/A INTRINSIC
low complexity region 448 461 N/A INTRINSIC
coiled coil region 523 565 N/A INTRINSIC
low complexity region 635 644 N/A INTRINSIC
low complexity region 679 700 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000135047
AA Change: Y241H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118451
Gene: ENSMUSG00000042292
AA Change: Y241H

DomainStartEndE-ValueType
RPEL 24 49 1.36e-8 SMART
RPEL 68 93 1.03e-8 SMART
low complexity region 111 124 N/A INTRINSIC
low complexity region 174 193 N/A INTRINSIC
low complexity region 224 237 N/A INTRINSIC
low complexity region 263 285 N/A INTRINSIC
low complexity region 305 330 N/A INTRINSIC
SAP 350 384 4.98e-10 SMART
low complexity region 389 398 N/A INTRINSIC
low complexity region 448 461 N/A INTRINSIC
coiled coil region 523 565 N/A INTRINSIC
low complexity region 635 644 N/A INTRINSIC
low complexity region 679 700 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138769
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145779
Predicted Effect probably damaging
Transcript: ENSMUST00000149582
AA Change: Y241H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117745
Gene: ENSMUSG00000042292
AA Change: Y241H

DomainStartEndE-ValueType
RPEL 24 49 1.36e-8 SMART
RPEL 68 93 1.03e-8 SMART
low complexity region 111 124 N/A INTRINSIC
low complexity region 174 193 N/A INTRINSIC
low complexity region 224 237 N/A INTRINSIC
low complexity region 263 285 N/A INTRINSIC
low complexity region 305 330 N/A INTRINSIC
SAP 350 384 4.98e-10 SMART
low complexity region 389 398 N/A INTRINSIC
low complexity region 448 461 N/A INTRINSIC
coiled coil region 523 565 N/A INTRINSIC
low complexity region 635 644 N/A INTRINSIC
low complexity region 679 700 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154797
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with the transcription factor myocardin, a key regulator of smooth muscle cell differentiation. The encoded protein is predominantly nuclear and may help transduce signals from the cytoskeleton to the nucleus. This gene is involved in a specific translocation event that creates a fusion of this gene and the RNA-binding motif protein-15 gene. This translocation has been associated with acute megakaryocytic leukemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit impaired mammary myoepithelial cell differentiation and fail to eject milk and productively nurse their offspring. Mice homozygous for another null allele show partial embryonic lethality caused by myocardial necrosis as well as mammary gland dysfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010005H15Rik A T 16: 36,257,365 Y96F possibly damaging Het
9230110C19Rik A T 9: 8,022,493 S243T possibly damaging Het
Abhd18 C G 3: 40,905,869 probably null Het
Adra2c A T 5: 35,280,361 Y159F probably damaging Het
AI481877 T C 4: 59,062,640 Y872C probably damaging Het
Alkal2 T A 12: 30,884,973 S64T probably benign Het
Apbb1ip T C 2: 22,823,349 V72A unknown Het
Atp13a5 A G 16: 29,378,500 L13P probably damaging Het
Azin2 G A 4: 128,934,653 P254S probably benign Het
Bmpr1b T C 3: 141,840,683 R481G probably damaging Het
Cacna2d4 G A 6: 119,268,196 W288* probably null Het
Cass4 A G 2: 172,427,869 T626A probably benign Het
Cep112 T A 11: 108,606,284 D683E probably damaging Het
Chat G T 14: 32,448,977 S188R possibly damaging Het
Cit A G 5: 115,863,028 Y162C possibly damaging Het
Clca3a1 T A 3: 144,737,961 Y676F probably damaging Het
Clec2h A G 6: 128,675,824 N185D probably benign Het
Cnbd2 G T 2: 156,339,221 V192F probably benign Het
Col6a3 C A 1: 90,802,427 G1112V probably damaging Het
Cyp3a25 A G 5: 145,977,671 F483S possibly damaging Het
Dscam T C 16: 96,683,818 E1103G probably benign Het
Dync2h1 G A 9: 7,131,921 Q1629* probably null Het
E330014E10Rik T C 5: 95,801,727 V111A probably benign Het
Enpp6 A G 8: 46,987,083 Y38C probably damaging Het
Epg5 T A 18: 77,985,057 L1271Q probably damaging Het
Fam47e G A 5: 92,574,669 V75I probably benign Het
Fat3 T C 9: 15,969,799 D3259G probably damaging Het
Fbxw28 T C 9: 109,330,853 D211G probably damaging Het
Flnc A G 6: 29,446,843 N990D probably benign Het
Frat1 T G 19: 41,830,322 L52R probably damaging Het
Ftmt C G 18: 52,331,586 probably benign Het
H2-M1 C T 17: 36,671,220 G163D probably benign Het
Hapln1 A G 13: 89,601,650 K105E possibly damaging Het
Igkv17-127 G T 6: 67,861,397 A31S probably benign Het
Il6st T C 13: 112,501,161 L628P probably damaging Het
Kcnj6 A G 16: 94,832,613 I213T probably damaging Het
Kidins220 T C 12: 25,013,443 probably null Het
Lama2 TTTGCGCATT TTT 10: 27,043,643 probably null Het
Llgl1 C T 11: 60,709,568 P581L probably benign Het
Marc2 A T 1: 184,845,624 I65N probably damaging Het
Mertk C A 2: 128,783,925 P660Q probably damaging Het
Napepld A G 5: 21,683,440 Y4H probably benign Het
Ncam1 T A 9: 49,545,251 probably null Het
Nuak2 A T 1: 132,324,986 K93* probably null Het
Oat A T 7: 132,564,222 D211E probably benign Het
Olfr1214 A C 2: 88,988,110 L31V probably null Het
Olfr1355 A T 10: 78,879,207 S12C probably benign Het
Olfr171 G A 16: 19,624,200 A300V probably benign Het
Olfr348 A G 2: 36,786,798 Q91R probably benign Het
Olfr64 A G 7: 103,893,465 I90T possibly damaging Het
Pde4dip C A 3: 97,709,558 K1789N probably damaging Het
Piezo2 T C 18: 63,078,791 I1322V possibly damaging Het
Pih1d1 A G 7: 45,154,527 probably benign Het
Plekhd1 T C 12: 80,722,327 S454P probably damaging Het
Polr2h G A 16: 20,720,553 V89M probably damaging Het
Pptc7 G A 5: 122,284,717 G17S possibly damaging Het
Ptpra T C 2: 130,544,436 V602A probably damaging Het
Rnf123 C T 9: 108,063,680 R654H probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Samsn1 A G 16: 75,879,103 S135P probably damaging Het
Sgsm3 A G 15: 81,006,779 N147S probably benign Het
Slc22a29 T C 19: 8,161,569 T510A probably benign Het
Smc4 T A 3: 69,031,811 H978Q probably damaging Het
Sox7 G A 14: 63,948,478 R321H probably damaging Het
Spred3 T C 7: 29,161,833 D307G probably damaging Het
Syne2 T A 12: 75,854,101 D11E probably benign Het
Tob1 ACAGCAGCAGCAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCAGCAGCAGCA 11: 94,214,452 probably benign Het
Top2b A T 14: 16,387,313 I134F probably damaging Het
Tspan1 T A 4: 116,163,366 R206* probably null Het
Ttc3 A T 16: 94,429,455 N837I probably damaging Het
Vmn1r36 T C 6: 66,716,565 T72A possibly damaging Het
Vmn2r10 A G 5: 109,003,458 S97P probably damaging Het
Zfp2 T A 11: 50,900,014 I401F probably damaging Het
Zfp629 T C 7: 127,611,018 T540A possibly damaging Het
Zfr G A 15: 12,166,145 V834I probably benign Het
Other mutations in Mkl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01344:Mkl1 APN 15 81016302 missense probably damaging 1.00
IGL02831:Mkl1 APN 15 81104793 missense probably benign 0.14
IGL03060:Mkl1 APN 15 81045322 missense probably damaging 1.00
R0594:Mkl1 UTSW 15 81017174 missense probably damaging 1.00
R0648:Mkl1 UTSW 15 81016920 missense probably damaging 1.00
R1085:Mkl1 UTSW 15 81020883 missense probably damaging 1.00
R1476:Mkl1 UTSW 15 81018208 splice site probably benign
R4030:Mkl1 UTSW 15 81015784 missense probably benign 0.01
R4232:Mkl1 UTSW 15 81023595 missense probably damaging 1.00
R4307:Mkl1 UTSW 15 81016347 missense possibly damaging 0.88
R4400:Mkl1 UTSW 15 81020923 nonsense probably null
R4795:Mkl1 UTSW 15 81017033 missense probably damaging 0.97
R4796:Mkl1 UTSW 15 81017033 missense probably damaging 0.97
R4801:Mkl1 UTSW 15 81104799 missense probably benign 0.15
R4802:Mkl1 UTSW 15 81104799 missense probably benign 0.15
R4967:Mkl1 UTSW 15 81045275 splice site probably benign
R5071:Mkl1 UTSW 15 81022426 missense probably damaging 1.00
R5072:Mkl1 UTSW 15 81022426 missense probably damaging 1.00
R5073:Mkl1 UTSW 15 81022426 missense probably damaging 1.00
R5074:Mkl1 UTSW 15 81022426 missense probably damaging 1.00
R6186:Mkl1 UTSW 15 81016652 missense probably damaging 1.00
R6512:Mkl1 UTSW 15 81013716 missense probably benign
R6581:Mkl1 UTSW 15 81016373 missense probably damaging 1.00
X0013:Mkl1 UTSW 15 81022436 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGGACTTGTGCTCCTACTTG -3'
(R):5'- ACGTCTTCTAGGATAGGGCCAG -3'

Sequencing Primer
(F):5'- TCCTACTTGGGAGGGGCAG -3'
(R):5'- CTTCTAGGATAGGGCCAGTGTCATAG -3'
Posted On2016-03-17