Incidental Mutation 'R4899:Olfr171'
ID376040
Institutional Source Beutler Lab
Gene Symbol Olfr171
Ensembl Gene ENSMUSG00000060480
Gene Nameolfactory receptor 171
SynonymsMOR273-1, MOR273-5, GA_x54KRFPKG5P-16071018-16070077
MMRRC Submission 042503-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R4899 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location19623930-19629916 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 19624200 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 300 (A300V)
Ref Sequence ENSEMBL: ENSMUSP00000145692 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079891] [ENSMUST00000205467]
Predicted Effect probably benign
Transcript: ENSMUST00000079891
AA Change: A301V

PolyPhen 2 Score 0.329 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000078814
Gene: ENSMUSG00000060480
AA Change: A301V

DomainStartEndE-ValueType
Pfam:7tm_4 29 309 2.6e-43 PFAM
Pfam:7TM_GPCR_Srsx 36 261 8.6e-6 PFAM
Pfam:7tm_1 42 291 3.3e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205467
AA Change: A300V

PolyPhen 2 Score 0.329 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010005H15Rik A T 16: 36,257,365 Y96F possibly damaging Het
9230110C19Rik A T 9: 8,022,493 S243T possibly damaging Het
Abhd18 C G 3: 40,905,869 probably null Het
Adra2c A T 5: 35,280,361 Y159F probably damaging Het
AI481877 T C 4: 59,062,640 Y872C probably damaging Het
Alkal2 T A 12: 30,884,973 S64T probably benign Het
Apbb1ip T C 2: 22,823,349 V72A unknown Het
Atp13a5 A G 16: 29,378,500 L13P probably damaging Het
Azin2 G A 4: 128,934,653 P254S probably benign Het
Bmpr1b T C 3: 141,840,683 R481G probably damaging Het
Cacna2d4 G A 6: 119,268,196 W288* probably null Het
Cass4 A G 2: 172,427,869 T626A probably benign Het
Cep112 T A 11: 108,606,284 D683E probably damaging Het
Chat G T 14: 32,448,977 S188R possibly damaging Het
Cit A G 5: 115,863,028 Y162C possibly damaging Het
Clca3a1 T A 3: 144,737,961 Y676F probably damaging Het
Clec2h A G 6: 128,675,824 N185D probably benign Het
Cnbd2 G T 2: 156,339,221 V192F probably benign Het
Col6a3 C A 1: 90,802,427 G1112V probably damaging Het
Cyp3a25 A G 5: 145,977,671 F483S possibly damaging Het
Dscam T C 16: 96,683,818 E1103G probably benign Het
Dync2h1 G A 9: 7,131,921 Q1629* probably null Het
E330014E10Rik T C 5: 95,801,727 V111A probably benign Het
Enpp6 A G 8: 46,987,083 Y38C probably damaging Het
Epg5 T A 18: 77,985,057 L1271Q probably damaging Het
Fam47e G A 5: 92,574,669 V75I probably benign Het
Fat3 T C 9: 15,969,799 D3259G probably damaging Het
Fbxw28 T C 9: 109,330,853 D211G probably damaging Het
Flnc A G 6: 29,446,843 N990D probably benign Het
Frat1 T G 19: 41,830,322 L52R probably damaging Het
Ftmt C G 18: 52,331,586 probably benign Het
H2-M1 C T 17: 36,671,220 G163D probably benign Het
Hapln1 A G 13: 89,601,650 K105E possibly damaging Het
Igkv17-127 G T 6: 67,861,397 A31S probably benign Het
Il6st T C 13: 112,501,161 L628P probably damaging Het
Kcnj6 A G 16: 94,832,613 I213T probably damaging Het
Kidins220 T C 12: 25,013,443 probably null Het
Lama2 TTTGCGCATT TTT 10: 27,043,643 probably null Het
Llgl1 C T 11: 60,709,568 P581L probably benign Het
Marc2 A T 1: 184,845,624 I65N probably damaging Het
Mertk C A 2: 128,783,925 P660Q probably damaging Het
Mkl1 A G 15: 81,018,386 Y241H probably damaging Het
Napepld A G 5: 21,683,440 Y4H probably benign Het
Ncam1 T A 9: 49,545,251 probably null Het
Nuak2 A T 1: 132,324,986 K93* probably null Het
Oat A T 7: 132,564,222 D211E probably benign Het
Olfr1214 A C 2: 88,988,110 L31V probably null Het
Olfr1355 A T 10: 78,879,207 S12C probably benign Het
Olfr348 A G 2: 36,786,798 Q91R probably benign Het
Olfr64 A G 7: 103,893,465 I90T possibly damaging Het
Pde4dip C A 3: 97,709,558 K1789N probably damaging Het
Piezo2 T C 18: 63,078,791 I1322V possibly damaging Het
Pih1d1 A G 7: 45,154,527 probably benign Het
Plekhd1 T C 12: 80,722,327 S454P probably damaging Het
Polr2h G A 16: 20,720,553 V89M probably damaging Het
Pptc7 G A 5: 122,284,717 G17S possibly damaging Het
Ptpra T C 2: 130,544,436 V602A probably damaging Het
Rnf123 C T 9: 108,063,680 R654H probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Samsn1 A G 16: 75,879,103 S135P probably damaging Het
Sgsm3 A G 15: 81,006,779 N147S probably benign Het
Slc22a29 T C 19: 8,161,569 T510A probably benign Het
Smc4 T A 3: 69,031,811 H978Q probably damaging Het
Sox7 G A 14: 63,948,478 R321H probably damaging Het
Spred3 T C 7: 29,161,833 D307G probably damaging Het
Syne2 T A 12: 75,854,101 D11E probably benign Het
Tob1 ACAGCAGCAGCAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCAGCAGCAGCA 11: 94,214,452 probably benign Het
Top2b A T 14: 16,387,313 I134F probably damaging Het
Tspan1 T A 4: 116,163,366 R206* probably null Het
Ttc3 A T 16: 94,429,455 N837I probably damaging Het
Vmn1r36 T C 6: 66,716,565 T72A possibly damaging Het
Vmn2r10 A G 5: 109,003,458 S97P probably damaging Het
Zfp2 T A 11: 50,900,014 I401F probably damaging Het
Zfp629 T C 7: 127,611,018 T540A possibly damaging Het
Zfr G A 15: 12,166,145 V834I probably benign Het
Other mutations in Olfr171
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02023:Olfr171 APN 16 19624408 missense probably benign 0.03
IGL02256:Olfr171 APN 16 19625006 missense probably benign 0.07
IGL02572:Olfr171 APN 16 19625098 start codon destroyed probably benign 0.01
IGL02966:Olfr171 APN 16 19624301 missense probably damaging 1.00
R0062:Olfr171 UTSW 16 19624417 missense probably benign 0.10
R3614:Olfr171 UTSW 16 19624765 missense probably damaging 1.00
R5070:Olfr171 UTSW 16 19624992 missense possibly damaging 0.47
R5334:Olfr171 UTSW 16 19624491 missense probably benign 0.02
R5718:Olfr171 UTSW 16 19624389 missense probably benign 0.06
R6490:Olfr171 UTSW 16 19624444 missense probably benign 0.03
R6632:Olfr171 UTSW 16 19625023 missense probably benign
X0057:Olfr171 UTSW 16 19624926 missense probably damaging 1.00
X0063:Olfr171 UTSW 16 19624708 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- AAGACTTTATCGTGGGCTTCTC -3'
(R):5'- CCAAATGCACTCATCAGGGG -3'

Sequencing Primer
(F):5'- ATCGTGGGCTTCTCTATACAGAC -3'
(R):5'- GGCCCGGCAAAAGTCCTTTTC -3'
Posted On2016-03-17