Incidental Mutation 'R4900:Skint6'
ID376075
Institutional Source Beutler Lab
Gene Symbol Skint6
Ensembl Gene ENSMUSG00000087194
Gene Nameselection and upkeep of intraepithelial T cells 6
SynonymsOTTMUSG00000008519
MMRRC Submission 042504-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R4900 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location112804616-113286973 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 113067470 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 522 (I522V)
Ref Sequence ENSEMBL: ENSMUSP00000132312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000138966] [ENSMUST00000171224]
Predicted Effect probably benign
Transcript: ENSMUST00000138966
AA Change: I522V

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000121870
Gene: ENSMUSG00000087194
AA Change: I522V

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGv 44 125 2.32e-8 SMART
internal_repeat_1 219 594 1.11e-41 PROSPERO
low complexity region 601 610 N/A INTRINSIC
low complexity region 678 690 N/A INTRINSIC
internal_repeat_1 701 1076 1.11e-41 PROSPERO
transmembrane domain 1087 1104 N/A INTRINSIC
transmembrane domain 1164 1186 N/A INTRINSIC
transmembrane domain 1206 1228 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171224
AA Change: I522V

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000132312
Gene: ENSMUSG00000087194
AA Change: I522V

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGv 44 125 2.32e-8 SMART
internal_repeat_1 219 594 1.11e-41 PROSPERO
low complexity region 601 610 N/A INTRINSIC
low complexity region 678 690 N/A INTRINSIC
internal_repeat_1 701 1076 1.11e-41 PROSPERO
transmembrane domain 1087 1104 N/A INTRINSIC
transmembrane domain 1164 1186 N/A INTRINSIC
transmembrane domain 1206 1228 N/A INTRINSIC
Meta Mutation Damage Score 0.1516 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency 100% (84/84)
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik T C 6: 91,918,110 V262A probably benign Het
Abtb2 A G 2: 103,567,004 E93G possibly damaging Het
Adam5 A C 8: 24,742,156 probably null Het
Adam5 G A 8: 24,781,603 T596I probably damaging Het
Adgrb2 T A 4: 130,013,875 Y1001N probably damaging Het
Aox2 T G 1: 58,305,385 S546A probably benign Het
Asic2 T C 11: 81,573,454 probably benign Het
Bcl11b T A 12: 107,989,698 N64I probably damaging Het
Cacna1g A G 11: 94,459,351 F556S possibly damaging Het
Cbl A G 9: 44,152,869 V790A probably benign Het
Cd300c2 A T 11: 115,000,981 C22* probably null Het
Cdh11 C T 8: 102,647,458 probably null Het
Ces2g C T 8: 104,967,357 Q442* probably null Het
Cps1 A T 1: 67,160,904 T404S probably damaging Het
Csf2rb2 A T 15: 78,285,974 probably null Het
Csmd2 A G 4: 128,452,525 Y1526C probably benign Het
Cyp2a12 C T 7: 27,031,215 Q202* probably null Het
Cyp2c39 G A 19: 39,513,576 M136I probably benign Het
Cyp2j13 G A 4: 96,059,043 T257I probably damaging Het
Dnah8 T A 17: 30,746,975 L2427Q probably damaging Het
Dopey2 G T 16: 93,763,430 probably null Het
Epcam T C 17: 87,643,621 V212A possibly damaging Het
Fam189a2 A G 19: 23,975,426 S507P possibly damaging Het
Flt1 C A 5: 147,683,939 A132S probably benign Het
Flvcr2 T A 12: 85,782,982 V255D probably damaging Het
Galc G T 12: 98,231,472 T326K probably damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gen1 A T 12: 11,241,560 Y808N probably benign Het
Glis1 C T 4: 107,619,564 A306V probably damaging Het
Gm10638 A G 8: 86,746,400 probably benign Het
Gm12789 G A 4: 101,988,985 probably benign Het
Gm1966 T G 7: 106,598,586 noncoding transcript Het
Gm27048 C T 8: 80,934,599 noncoding transcript Het
Gm4204 T C 1: 135,232,818 noncoding transcript Het
Gm904 A T 13: 50,645,289 I95F possibly damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Ints11 G A 4: 155,888,430 D526N probably benign Het
Itfg2 A G 6: 128,416,316 probably benign Het
Jund T C 8: 70,699,605 V183A probably damaging Het
Kcnj8 A G 6: 142,566,495 S129P probably damaging Het
Kcnq3 A G 15: 65,995,410 S795P probably damaging Het
Lhx8 G T 3: 154,330,288 A22E probably benign Het
Lrp8 A G 4: 107,806,809 probably benign Het
Lvrn G T 18: 46,893,701 A789S probably damaging Het
Lvrn T C 18: 46,881,412 S526P probably damaging Het
Mga T A 2: 119,964,054 C2622S possibly damaging Het
Mroh8 T C 2: 157,228,727 E568G probably benign Het
Ms4a4b C A 19: 11,463,139 probably benign Het
Muc2 T C 7: 141,749,543 F99S probably benign Het
Myo5c T A 9: 75,273,543 I738N probably damaging Het
Naip6 A C 13: 100,296,969 V1120G probably damaging Het
Ncl T C 1: 86,356,179 T307A probably benign Het
Npr1 A T 3: 90,455,965 D869E possibly damaging Het
Nup93 A G 8: 94,286,603 T36A probably benign Het
Olfml2b C A 1: 170,662,378 T189N probably damaging Het
Olfr1255 A G 2: 89,816,968 N208S possibly damaging Het
Olfr877 T C 9: 37,855,312 F165L probably benign Het
P4htm A C 9: 108,579,228 W458G probably damaging Het
Pdzrn4 G T 15: 92,770,757 R930L probably damaging Het
Pgam5 G A 5: 110,260,435 A240V probably damaging Het
Prex2 T C 1: 11,149,905 probably benign Het
Ptpru T G 4: 131,788,382 E897A probably damaging Het
Rapgef2 A T 3: 79,074,363 N1256K probably benign Het
Rhbdl3 A G 11: 80,319,613 E64G probably benign Het
Sel1l3 A T 5: 53,131,842 L879Q probably damaging Het
Siah1a G T 8: 86,725,075 D260E probably benign Het
Slco4c1 G A 1: 96,841,228 P303L probably damaging Het
Smok3c T C 5: 138,064,551 I100T probably damaging Het
Snx24 C A 18: 53,385,223 Y141* probably null Het
Tigit A G 16: 43,649,231 S166P probably damaging Het
Tmem183a C T 1: 134,348,166 R324Q probably benign Het
Tmie T C 9: 110,866,933 D130G possibly damaging Het
Uggt1 G A 1: 36,202,855 R333* probably null Het
Vmn2r111 T C 17: 22,548,656 N620S possibly damaging Het
Vmn2r12 T A 5: 109,092,986 N87I probably damaging Het
Vmn2r92 A G 17: 18,184,343 D583G probably benign Het
Zdhhc17 T C 10: 110,985,958 D60G possibly damaging Het
Other mutations in Skint6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Skint6 APN 4 112804682 missense possibly damaging 0.96
IGL01296:Skint6 APN 4 113236440 missense probably benign 0.37
IGL01343:Skint6 APN 4 113283626 missense probably benign 0.07
IGL01543:Skint6 APN 4 112899963 missense probably benign 0.18
IGL01633:Skint6 APN 4 113238049 missense probably damaging 1.00
IGL01818:Skint6 APN 4 112948569 missense probably benign 0.18
IGL02124:Skint6 APN 4 113087796 missense probably benign
IGL02517:Skint6 APN 4 112948540 splice site probably benign
IGL02647:Skint6 APN 4 113127891 splice site probably benign
IGL02887:Skint6 APN 4 113238184 nonsense probably null
IGL03026:Skint6 APN 4 112991244 splice site probably null
IGL03030:Skint6 APN 4 113012956 missense probably benign 0.03
PIT4576001:Skint6 UTSW 4 113053367 missense possibly damaging 0.91
R0058:Skint6 UTSW 4 113046815 splice site probably benign
R0058:Skint6 UTSW 4 113046815 splice site probably benign
R0099:Skint6 UTSW 4 112811501 missense possibly damaging 0.53
R0158:Skint6 UTSW 4 113184814 splice site probably benign
R0164:Skint6 UTSW 4 112991236 splice site probably benign
R0312:Skint6 UTSW 4 112809100 missense possibly damaging 0.86
R0591:Skint6 UTSW 4 112858169 splice site probably benign
R0762:Skint6 UTSW 4 112865651 splice site probably benign
R0941:Skint6 UTSW 4 113238358 missense probably damaging 1.00
R1023:Skint6 UTSW 4 113238103 missense probably benign 0.20
R1132:Skint6 UTSW 4 112898099 critical splice donor site probably null
R1228:Skint6 UTSW 4 112854452 missense probably benign
R1338:Skint6 UTSW 4 113012961 missense possibly damaging 0.53
R1432:Skint6 UTSW 4 112869524 splice site probably benign
R1512:Skint6 UTSW 4 113238132 missense probably damaging 1.00
R1577:Skint6 UTSW 4 113148523 missense possibly damaging 0.53
R1733:Skint6 UTSW 4 113177037 splice site probably benign
R1762:Skint6 UTSW 4 113236481 missense probably damaging 0.98
R1891:Skint6 UTSW 4 112846696 missense possibly damaging 0.85
R1908:Skint6 UTSW 4 112891990 missense probably benign
R2069:Skint6 UTSW 4 113238132 missense probably damaging 1.00
R2089:Skint6 UTSW 4 112846684 missense probably benign
R2091:Skint6 UTSW 4 112846684 missense probably benign
R2091:Skint6 UTSW 4 112846684 missense probably benign
R2144:Skint6 UTSW 4 113236260 missense possibly damaging 0.84
R2166:Skint6 UTSW 4 112854452 missense probably benign 0.01
R2192:Skint6 UTSW 4 112865712 nonsense probably null
R2267:Skint6 UTSW 4 112842822 intron probably null
R2312:Skint6 UTSW 4 113238142 missense probably damaging 1.00
R2324:Skint6 UTSW 4 112872457 splice site probably null
R2342:Skint6 UTSW 4 113176983 missense probably benign 0.00
R3028:Skint6 UTSW 4 113236493 missense possibly damaging 0.92
R3704:Skint6 UTSW 4 113136472 missense possibly damaging 0.86
R3752:Skint6 UTSW 4 112842899 splice site probably benign
R3760:Skint6 UTSW 4 112937458 missense possibly damaging 0.53
R3827:Skint6 UTSW 4 112937437 missense probably benign
R4377:Skint6 UTSW 4 113236518 missense possibly damaging 0.90
R4406:Skint6 UTSW 4 113156486 missense probably benign 0.01
R4611:Skint6 UTSW 4 113074076 missense probably benign
R4780:Skint6 UTSW 4 113236397 missense probably damaging 0.98
R4788:Skint6 UTSW 4 113238336 missense possibly damaging 0.54
R4818:Skint6 UTSW 4 112955392 intron probably benign
R4972:Skint6 UTSW 4 112835068 missense probably benign
R5008:Skint6 UTSW 4 112991255 missense possibly damaging 0.86
R5016:Skint6 UTSW 4 113171533 critical splice acceptor site probably null
R5085:Skint6 UTSW 4 113236268 missense probably damaging 0.99
R5165:Skint6 UTSW 4 112865668 missense possibly damaging 0.86
R5221:Skint6 UTSW 4 112894924 intron probably null
R5310:Skint6 UTSW 4 113184768 nonsense probably null
R5423:Skint6 UTSW 4 112850740 missense possibly damaging 0.93
R5436:Skint6 UTSW 4 113096591 missense probably benign 0.08
R5447:Skint6 UTSW 4 113105909 missense probably benign 0.34
R5564:Skint6 UTSW 4 112988965 missense possibly damaging 0.72
R5629:Skint6 UTSW 4 113012979 missense possibly damaging 0.86
R5936:Skint6 UTSW 4 113096593 missense probably benign 0.33
R5993:Skint6 UTSW 4 112809079 missense probably benign 0.02
R6027:Skint6 UTSW 4 113096564 splice site probably null
R6174:Skint6 UTSW 4 112839313 missense possibly damaging 0.53
R6497:Skint6 UTSW 4 113236398 missense probably damaging 0.98
R6552:Skint6 UTSW 4 113067490 missense possibly damaging 0.86
R6645:Skint6 UTSW 4 112892038 missense possibly damaging 0.53
R6810:Skint6 UTSW 4 112948380 intron probably null
R7003:Skint6 UTSW 4 113105912 missense probably benign 0.01
R7211:Skint6 UTSW 4 113238369 missense probably benign 0.09
R7269:Skint6 UTSW 4 112854489 intron probably null
R7398:Skint6 UTSW 4 112898138 missense probably benign 0.00
R7438:Skint6 UTSW 4 113238228 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGCCTAGGATCAAGAAGCTG -3'
(R):5'- TGTCAGAGCCCAGCATTTC -3'

Sequencing Primer
(F):5'- GCCTAGGATCAAGAAGCTGAATATTC -3'
(R):5'- AGCCCAGCATTTCTTGTTGCAATAG -3'
Posted On2016-03-17