Incidental Mutation 'R4900:Myo5c'
ID376100
Institutional Source Beutler Lab
Gene Symbol Myo5c
Ensembl Gene ENSMUSG00000033590
Gene Namemyosin VC
Synonyms9130003O20Rik
MMRRC Submission 042504-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R4900 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location75232020-75305451 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 75273543 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 738 (I738N)
Ref Sequence ENSEMBL: ENSMUSP00000042229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036555] [ENSMUST00000216788]
Predicted Effect probably damaging
Transcript: ENSMUST00000036555
AA Change: I738N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000042229
Gene: ENSMUSG00000033590
AA Change: I738N

DomainStartEndE-ValueType
MYSc 61 754 N/A SMART
IQ 755 777 1.11e-3 SMART
IQ 778 800 1.39e0 SMART
IQ 806 828 8.98e-4 SMART
IQ 829 851 4.19e-4 SMART
IQ 854 876 2.54e-3 SMART
coiled coil region 1160 1185 N/A INTRINSIC
coiled coil region 1207 1245 N/A INTRINSIC
DIL 1574 1679 5.54e-45 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000216788
Meta Mutation Damage Score 0.328 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency 100% (84/84)
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik T C 6: 91,918,110 V262A probably benign Het
Abtb2 A G 2: 103,567,004 E93G possibly damaging Het
Adam5 A C 8: 24,742,156 probably null Het
Adam5 G A 8: 24,781,603 T596I probably damaging Het
Adgrb2 T A 4: 130,013,875 Y1001N probably damaging Het
Aox2 T G 1: 58,305,385 S546A probably benign Het
Asic2 T C 11: 81,573,454 probably benign Het
Bcl11b T A 12: 107,989,698 N64I probably damaging Het
Cacna1g A G 11: 94,459,351 F556S possibly damaging Het
Cbl A G 9: 44,152,869 V790A probably benign Het
Cd300c2 A T 11: 115,000,981 C22* probably null Het
Cdh11 C T 8: 102,647,458 probably null Het
Ces2g C T 8: 104,967,357 Q442* probably null Het
Cps1 A T 1: 67,160,904 T404S probably damaging Het
Csf2rb2 A T 15: 78,285,974 probably null Het
Csmd2 A G 4: 128,452,525 Y1526C probably benign Het
Cyp2a12 C T 7: 27,031,215 Q202* probably null Het
Cyp2c39 G A 19: 39,513,576 M136I probably benign Het
Cyp2j13 G A 4: 96,059,043 T257I probably damaging Het
Dnah8 T A 17: 30,746,975 L2427Q probably damaging Het
Dopey2 G T 16: 93,763,430 probably null Het
Epcam T C 17: 87,643,621 V212A possibly damaging Het
Fam189a2 A G 19: 23,975,426 S507P possibly damaging Het
Flt1 C A 5: 147,683,939 A132S probably benign Het
Flvcr2 T A 12: 85,782,982 V255D probably damaging Het
Galc G T 12: 98,231,472 T326K probably damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gen1 A T 12: 11,241,560 Y808N probably benign Het
Glis1 C T 4: 107,619,564 A306V probably damaging Het
Gm10638 A G 8: 86,746,400 probably benign Het
Gm12789 G A 4: 101,988,985 probably benign Het
Gm1966 T G 7: 106,598,586 noncoding transcript Het
Gm27048 C T 8: 80,934,599 noncoding transcript Het
Gm4204 T C 1: 135,232,818 noncoding transcript Het
Gm904 A T 13: 50,645,289 I95F possibly damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Ints11 G A 4: 155,888,430 D526N probably benign Het
Itfg2 A G 6: 128,416,316 probably benign Het
Jund T C 8: 70,699,605 V183A probably damaging Het
Kcnj8 A G 6: 142,566,495 S129P probably damaging Het
Kcnq3 A G 15: 65,995,410 S795P probably damaging Het
Lhx8 G T 3: 154,330,288 A22E probably benign Het
Lrp8 A G 4: 107,806,809 probably benign Het
Lvrn G T 18: 46,893,701 A789S probably damaging Het
Lvrn T C 18: 46,881,412 S526P probably damaging Het
Mga T A 2: 119,964,054 C2622S possibly damaging Het
Mroh8 T C 2: 157,228,727 E568G probably benign Het
Ms4a4b C A 19: 11,463,139 probably benign Het
Muc2 T C 7: 141,749,543 F99S probably benign Het
Naip6 A C 13: 100,296,969 V1120G probably damaging Het
Ncl T C 1: 86,356,179 T307A probably benign Het
Npr1 A T 3: 90,455,965 D869E possibly damaging Het
Nup93 A G 8: 94,286,603 T36A probably benign Het
Olfml2b C A 1: 170,662,378 T189N probably damaging Het
Olfr1255 A G 2: 89,816,968 N208S possibly damaging Het
Olfr877 T C 9: 37,855,312 F165L probably benign Het
P4htm A C 9: 108,579,228 W458G probably damaging Het
Pdzrn4 G T 15: 92,770,757 R930L probably damaging Het
Pgam5 G A 5: 110,260,435 A240V probably damaging Het
Prex2 T C 1: 11,149,905 probably benign Het
Ptpru T G 4: 131,788,382 E897A probably damaging Het
Rapgef2 A T 3: 79,074,363 N1256K probably benign Het
Rhbdl3 A G 11: 80,319,613 E64G probably benign Het
Sel1l3 A T 5: 53,131,842 L879Q probably damaging Het
Siah1a G T 8: 86,725,075 D260E probably benign Het
Skint6 T C 4: 113,067,470 I522V probably benign Het
Slco4c1 G A 1: 96,841,228 P303L probably damaging Het
Smok3c T C 5: 138,064,551 I100T probably damaging Het
Snx24 C A 18: 53,385,223 Y141* probably null Het
Tigit A G 16: 43,649,231 S166P probably damaging Het
Tmem183a C T 1: 134,348,166 R324Q probably benign Het
Tmie T C 9: 110,866,933 D130G possibly damaging Het
Uggt1 G A 1: 36,202,855 R333* probably null Het
Vmn2r111 T C 17: 22,548,656 N620S possibly damaging Het
Vmn2r12 T A 5: 109,092,986 N87I probably damaging Het
Vmn2r92 A G 17: 18,184,343 D583G probably benign Het
Zdhhc17 T C 10: 110,985,958 D60G possibly damaging Het
Other mutations in Myo5c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Myo5c APN 9 75242880 splice site probably benign
IGL00848:Myo5c APN 9 75289181 missense probably benign
IGL01503:Myo5c APN 9 75263042 missense probably damaging 1.00
IGL01735:Myo5c APN 9 75301438 missense probably damaging 1.00
IGL01866:Myo5c APN 9 75269582 missense probably benign 0.00
IGL01956:Myo5c APN 9 75242876 splice site probably null
IGL02127:Myo5c APN 9 75300902 missense probably damaging 1.00
IGL02268:Myo5c APN 9 75246237 missense probably damaging 1.00
IGL02272:Myo5c APN 9 75266160 missense possibly damaging 0.73
IGL03052:Myo5c APN 9 75252516 splice site probably benign
IGL03179:Myo5c APN 9 75255866 missense possibly damaging 0.65
IGL03224:Myo5c APN 9 75278243 missense probably benign 0.01
PIT4142001:Myo5c UTSW 9 75283948 missense probably benign 0.00
R0126:Myo5c UTSW 9 75269525 missense probably benign 0.05
R0266:Myo5c UTSW 9 75284216 splice site probably benign
R0345:Myo5c UTSW 9 75297419 missense probably damaging 1.00
R0387:Myo5c UTSW 9 75285021 splice site probably benign
R0602:Myo5c UTSW 9 75266196 splice site probably null
R0675:Myo5c UTSW 9 75278289 missense probably benign
R0798:Myo5c UTSW 9 75257984 missense probably damaging 1.00
R0981:Myo5c UTSW 9 75271591 missense probably damaging 1.00
R1051:Myo5c UTSW 9 75290883 missense probably benign 0.00
R1072:Myo5c UTSW 9 75292208 missense probably damaging 1.00
R1144:Myo5c UTSW 9 75286448 missense probably damaging 1.00
R1454:Myo5c UTSW 9 75263066 missense possibly damaging 0.94
R1476:Myo5c UTSW 9 75275939 missense probably damaging 1.00
R1484:Myo5c UTSW 9 75300810 missense probably damaging 1.00
R1586:Myo5c UTSW 9 75267031 missense probably damaging 0.99
R1616:Myo5c UTSW 9 75296017 missense probably damaging 1.00
R1635:Myo5c UTSW 9 75277075 missense probably benign 0.09
R1800:Myo5c UTSW 9 75246164 missense probably damaging 1.00
R1838:Myo5c UTSW 9 75273553 missense probably damaging 1.00
R1840:Myo5c UTSW 9 75249735 missense probably damaging 1.00
R1885:Myo5c UTSW 9 75249761 missense probably damaging 1.00
R1897:Myo5c UTSW 9 75292241 missense probably benign 0.20
R1898:Myo5c UTSW 9 75297626 missense probably damaging 1.00
R2029:Myo5c UTSW 9 75289055 unclassified probably benign
R2063:Myo5c UTSW 9 75281868 missense probably benign 0.19
R2230:Myo5c UTSW 9 75273606 missense probably benign
R2519:Myo5c UTSW 9 75250436 missense probably damaging 1.00
R2520:Myo5c UTSW 9 75297649 nonsense probably null
R3034:Myo5c UTSW 9 75286577 missense probably benign 0.44
R3117:Myo5c UTSW 9 75266194 critical splice donor site probably null
R3432:Myo5c UTSW 9 75263001 missense probably damaging 1.00
R3751:Myo5c UTSW 9 75276002 missense probably damaging 1.00
R4132:Myo5c UTSW 9 75252568 missense probably benign 0.00
R4173:Myo5c UTSW 9 75246258 missense probably damaging 1.00
R4239:Myo5c UTSW 9 75283942 missense probably benign 0.01
R4429:Myo5c UTSW 9 75294001 missense probably damaging 1.00
R4574:Myo5c UTSW 9 75269611 missense probably benign 0.00
R4791:Myo5c UTSW 9 75290916 missense probably damaging 1.00
R4804:Myo5c UTSW 9 75245024 missense probably damaging 1.00
R4819:Myo5c UTSW 9 75292202 missense probably damaging 0.97
R4881:Myo5c UTSW 9 75284152 missense probably benign 0.00
R4964:Myo5c UTSW 9 75297509 missense possibly damaging 0.51
R4966:Myo5c UTSW 9 75269596 missense probably benign 0.03
R5057:Myo5c UTSW 9 75300873 missense probably damaging 1.00
R5347:Myo5c UTSW 9 75295205 missense probably null 1.00
R5399:Myo5c UTSW 9 75288074 missense possibly damaging 0.80
R5440:Myo5c UTSW 9 75258125 missense possibly damaging 0.91
R5569:Myo5c UTSW 9 75273510 missense probably damaging 1.00
R5600:Myo5c UTSW 9 75289154 missense probably benign 0.00
R5606:Myo5c UTSW 9 75275508 missense probably damaging 1.00
R5704:Myo5c UTSW 9 75272903 missense probably benign 0.00
R5798:Myo5c UTSW 9 75284198 missense probably benign 0.04
R5865:Myo5c UTSW 9 75297488 missense probably damaging 0.97
R6034:Myo5c UTSW 9 75255905 missense probably benign 0.05
R6034:Myo5c UTSW 9 75255905 missense probably benign 0.05
R6143:Myo5c UTSW 9 75249809 missense probably damaging 1.00
R6242:Myo5c UTSW 9 75273611 missense probably benign
R6253:Myo5c UTSW 9 75245037 missense probably damaging 1.00
R6264:Myo5c UTSW 9 75275554 missense probably benign
R6307:Myo5c UTSW 9 75272916 missense possibly damaging 0.73
R6358:Myo5c UTSW 9 75296012 missense possibly damaging 0.53
R6450:Myo5c UTSW 9 75286578 missense probably benign 0.26
R6598:Myo5c UTSW 9 75246234 missense probably damaging 1.00
R6618:Myo5c UTSW 9 75275637 critical splice donor site probably null
R6774:Myo5c UTSW 9 75289186 missense probably benign 0.05
R6865:Myo5c UTSW 9 75269596 missense probably benign 0.03
Z1088:Myo5c UTSW 9 75245059 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATGGCAAGCTATGATGCC -3'
(R):5'- AAGTCACTGGTGTAACCCCAG -3'

Sequencing Primer
(F):5'- CAAGCTATGATGCCCAGGAAATG -3'
(R):5'- TGGTGTAACCCCAGTGCCTC -3'
Posted On2016-03-17