Incidental Mutation 'R4900:Vmn2r92'
ID376121
Institutional Source Beutler Lab
Gene Symbol Vmn2r92
Ensembl Gene ENSMUSG00000091350
Gene Namevomeronasal 2, receptor 92
SynonymsEG627111
MMRRC Submission 042504-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R4900 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location18151887-18188886 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 18184343 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 583 (D583G)
Ref Sequence ENSEMBL: ENSMUSP00000128685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169686]
Predicted Effect probably benign
Transcript: ENSMUST00000169686
AA Change: D583G

PolyPhen 2 Score 0.271 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000128685
Gene: ENSMUSG00000091350
AA Change: D583G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 83 463 4.7e-38 PFAM
Pfam:NCD3G 510 564 2.5e-19 PFAM
Pfam:7tm_3 597 832 1.1e-52 PFAM
low complexity region 843 855 N/A INTRINSIC
Meta Mutation Damage Score 0.1204 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency 100% (84/84)
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik T C 6: 91,918,110 V262A probably benign Het
Abtb2 A G 2: 103,567,004 E93G possibly damaging Het
Adam5 A C 8: 24,742,156 probably null Het
Adam5 G A 8: 24,781,603 T596I probably damaging Het
Adgrb2 T A 4: 130,013,875 Y1001N probably damaging Het
Aox2 T G 1: 58,305,385 S546A probably benign Het
Asic2 T C 11: 81,573,454 probably benign Het
Bcl11b T A 12: 107,989,698 N64I probably damaging Het
Cacna1g A G 11: 94,459,351 F556S possibly damaging Het
Cbl A G 9: 44,152,869 V790A probably benign Het
Cd300c2 A T 11: 115,000,981 C22* probably null Het
Cdh11 C T 8: 102,647,458 probably null Het
Ces2g C T 8: 104,967,357 Q442* probably null Het
Cps1 A T 1: 67,160,904 T404S probably damaging Het
Csf2rb2 A T 15: 78,285,974 probably null Het
Csmd2 A G 4: 128,452,525 Y1526C probably benign Het
Cyp2a12 C T 7: 27,031,215 Q202* probably null Het
Cyp2c39 G A 19: 39,513,576 M136I probably benign Het
Cyp2j13 G A 4: 96,059,043 T257I probably damaging Het
Dnah8 T A 17: 30,746,975 L2427Q probably damaging Het
Dopey2 G T 16: 93,763,430 probably null Het
Epcam T C 17: 87,643,621 V212A possibly damaging Het
Fam189a2 A G 19: 23,975,426 S507P possibly damaging Het
Flt1 C A 5: 147,683,939 A132S probably benign Het
Flvcr2 T A 12: 85,782,982 V255D probably damaging Het
Galc G T 12: 98,231,472 T326K probably damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gen1 A T 12: 11,241,560 Y808N probably benign Het
Glis1 C T 4: 107,619,564 A306V probably damaging Het
Gm10638 A G 8: 86,746,400 probably benign Het
Gm12789 G A 4: 101,988,985 probably benign Het
Gm1966 T G 7: 106,598,586 noncoding transcript Het
Gm27048 C T 8: 80,934,599 noncoding transcript Het
Gm4204 T C 1: 135,232,818 noncoding transcript Het
Gm904 A T 13: 50,645,289 I95F possibly damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Ints11 G A 4: 155,888,430 D526N probably benign Het
Itfg2 A G 6: 128,416,316 probably benign Het
Jund T C 8: 70,699,605 V183A probably damaging Het
Kcnj8 A G 6: 142,566,495 S129P probably damaging Het
Kcnq3 A G 15: 65,995,410 S795P probably damaging Het
Lhx8 G T 3: 154,330,288 A22E probably benign Het
Lrp8 A G 4: 107,806,809 probably benign Het
Lvrn G T 18: 46,893,701 A789S probably damaging Het
Lvrn T C 18: 46,881,412 S526P probably damaging Het
Mga T A 2: 119,964,054 C2622S possibly damaging Het
Mroh8 T C 2: 157,228,727 E568G probably benign Het
Ms4a4b C A 19: 11,463,139 probably benign Het
Muc2 T C 7: 141,749,543 F99S probably benign Het
Myo5c T A 9: 75,273,543 I738N probably damaging Het
Naip6 A C 13: 100,296,969 V1120G probably damaging Het
Ncl T C 1: 86,356,179 T307A probably benign Het
Npr1 A T 3: 90,455,965 D869E possibly damaging Het
Nup93 A G 8: 94,286,603 T36A probably benign Het
Olfml2b C A 1: 170,662,378 T189N probably damaging Het
Olfr1255 A G 2: 89,816,968 N208S possibly damaging Het
Olfr877 T C 9: 37,855,312 F165L probably benign Het
P4htm A C 9: 108,579,228 W458G probably damaging Het
Pdzrn4 G T 15: 92,770,757 R930L probably damaging Het
Pgam5 G A 5: 110,260,435 A240V probably damaging Het
Prex2 T C 1: 11,149,905 probably benign Het
Ptpru T G 4: 131,788,382 E897A probably damaging Het
Rapgef2 A T 3: 79,074,363 N1256K probably benign Het
Rhbdl3 A G 11: 80,319,613 E64G probably benign Het
Sel1l3 A T 5: 53,131,842 L879Q probably damaging Het
Siah1a G T 8: 86,725,075 D260E probably benign Het
Skint6 T C 4: 113,067,470 I522V probably benign Het
Slco4c1 G A 1: 96,841,228 P303L probably damaging Het
Smok3c T C 5: 138,064,551 I100T probably damaging Het
Snx24 C A 18: 53,385,223 Y141* probably null Het
Tigit A G 16: 43,649,231 S166P probably damaging Het
Tmem183a C T 1: 134,348,166 R324Q probably benign Het
Tmie T C 9: 110,866,933 D130G possibly damaging Het
Uggt1 G A 1: 36,202,855 R333* probably null Het
Vmn2r111 T C 17: 22,548,656 N620S possibly damaging Het
Vmn2r12 T A 5: 109,092,986 N87I probably damaging Het
Zdhhc17 T C 10: 110,985,958 D60G possibly damaging Het
Other mutations in Vmn2r92
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01591:Vmn2r92 APN 17 18185161 missense unknown
IGL01758:Vmn2r92 APN 17 18152013 nonsense probably null
IGL02614:Vmn2r92 APN 17 18167241 splice site probably benign
IGL03095:Vmn2r92 APN 17 18166710 missense possibly damaging 0.55
IGL03403:Vmn2r92 APN 17 18166852 missense probably damaging 0.98
R0133:Vmn2r92 UTSW 17 18167957 missense probably damaging 1.00
R0225:Vmn2r92 UTSW 17 18167957 missense probably damaging 1.00
R0227:Vmn2r92 UTSW 17 18167957 missense probably damaging 1.00
R0265:Vmn2r92 UTSW 17 18167957 missense probably damaging 1.00
R0266:Vmn2r92 UTSW 17 18167957 missense probably damaging 1.00
R0267:Vmn2r92 UTSW 17 18167957 missense probably damaging 1.00
R0420:Vmn2r92 UTSW 17 18168921 missense probably benign 0.01
R0426:Vmn2r92 UTSW 17 18167957 missense probably damaging 1.00
R0494:Vmn2r92 UTSW 17 18167957 missense probably damaging 1.00
R1253:Vmn2r92 UTSW 17 18166766 missense probably benign 0.08
R1497:Vmn2r92 UTSW 17 18167363 missense probably benign 0.02
R1571:Vmn2r92 UTSW 17 18152090 missense probably damaging 0.96
R1656:Vmn2r92 UTSW 17 18151936 missense probably benign
R1816:Vmn2r92 UTSW 17 18166677 missense probably damaging 0.98
R2229:Vmn2r92 UTSW 17 18167392 missense probably benign 0.01
R2909:Vmn2r92 UTSW 17 18185115 missense possibly damaging 0.89
R3694:Vmn2r92 UTSW 17 18151943 nonsense probably null
R4207:Vmn2r92 UTSW 17 18184261 missense possibly damaging 0.62
R4548:Vmn2r92 UTSW 17 18171316 missense probably benign
R4612:Vmn2r92 UTSW 17 18166870 missense probably benign 0.25
R4742:Vmn2r92 UTSW 17 18166857 missense probably benign 0.06
R4824:Vmn2r92 UTSW 17 18151921 utr 5 prime probably benign
R4865:Vmn2r92 UTSW 17 18167372 missense probably benign 0.16
R5084:Vmn2r92 UTSW 17 18185177 makesense probably null
R5140:Vmn2r92 UTSW 17 18152050 missense probably benign 0.07
R5995:Vmn2r92 UTSW 17 18168951 critical splice donor site probably null
R6045:Vmn2r92 UTSW 17 18168043 critical splice donor site probably null
R6269:Vmn2r92 UTSW 17 18166774 missense probably benign 0.01
R6877:Vmn2r92 UTSW 17 18168822 missense probably damaging 1.00
R7151:Vmn2r92 UTSW 17 18166743 missense probably benign 0.01
R7260:Vmn2r92 UTSW 17 18166876 missense probably damaging 1.00
R7344:Vmn2r92 UTSW 17 18167251 missense probably benign 0.01
X0066:Vmn2r92 UTSW 17 18184895 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCATGACTTCTGAGATAGTCC -3'
(R):5'- GCAAAGGTGGTCTGCTGAAG -3'

Sequencing Primer
(F):5'- ACTTCTGAGATAGTCCCTGTAATTAG -3'
(R):5'- GCTGACCAATGAAGTTCAAAGAAC -3'
Posted On2016-03-17