Incidental Mutation 'R4867:Dlc1'
ID376239
Institutional Source Beutler Lab
Gene Symbol Dlc1
Ensembl Gene ENSMUSG00000031523
Gene Namedeleted in liver cancer 1
SynonymsArhgap7, A730069N07Rik, STARD12, p122-RhoGAP
MMRRC Submission 042477-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4867 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location36567751-36953143 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36584645 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 644 (H644R)
Ref Sequence ENSEMBL: ENSMUSP00000132812 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033923] [ENSMUST00000098826] [ENSMUST00000163663]
Predicted Effect probably benign
Transcript: ENSMUST00000033923
AA Change: H193R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000033923
Gene: ENSMUSG00000031523
AA Change: H193R

DomainStartEndE-ValueType
Pfam:SAM_2 15 76 2.2e-7 PFAM
low complexity region 154 174 N/A INTRINSIC
low complexity region 238 250 N/A INTRINSIC
low complexity region 298 325 N/A INTRINSIC
low complexity region 427 441 N/A INTRINSIC
RhoGAP 653 845 8.82e-59 SMART
START 887 1088 3.93e-59 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098826
AA Change: H227R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000096425
Gene: ENSMUSG00000031523
AA Change: H227R

DomainStartEndE-ValueType
Pfam:SAM_2 49 110 5.9e-8 PFAM
low complexity region 188 208 N/A INTRINSIC
low complexity region 272 284 N/A INTRINSIC
low complexity region 332 359 N/A INTRINSIC
low complexity region 461 475 N/A INTRINSIC
RhoGAP 687 879 8.82e-59 SMART
START 921 1122 3.93e-59 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163663
AA Change: H644R

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000132812
Gene: ENSMUSG00000031523
AA Change: H644R

DomainStartEndE-ValueType
low complexity region 353 369 N/A INTRINSIC
low complexity region 388 403 N/A INTRINSIC
Pfam:SAM_2 466 527 1.2e-7 PFAM
low complexity region 605 625 N/A INTRINSIC
low complexity region 689 701 N/A INTRINSIC
low complexity region 749 776 N/A INTRINSIC
low complexity region 878 892 N/A INTRINSIC
RhoGAP 1104 1296 8.82e-59 SMART
START 1338 1539 3.93e-59 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a GTPase-activating protein (GAP) that is a member of the rhoGAP family of proteins which play a role in the regulation of small GTP-binding proteins. GAP family proteins participate in signaling pathways that regulate cell processes involved in cytoskeletal changes. This gene functions as a tumor suppressor gene in a number of common cancers, including prostate, lung, colorectal, and breast cancers. Multiple transcript variants due to alternative promoters and alternative splicing have been found for this gene.[provided by RefSeq, Apr 2010]
PHENOTYPE: Homozygous mutants die by E10.5 with variable defects in the neural tube, heart, brain and placenta. Mouse embryonic fibroblasts homozygous for an activated conditional allele exhibti increased sensitivity to Ras-induced transformation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022B05Rik T C 8: 124,639,360 I215V probably damaging Het
4921509C19Rik A T 2: 151,472,822 L312* probably null Het
9930111J21Rik1 T A 11: 48,948,548 probably null Het
Abca6 C A 11: 110,202,379 V1023F probably benign Het
Ablim2 C T 5: 35,802,422 R73C possibly damaging Het
Acsbg2 A G 17: 56,862,914 I151T possibly damaging Het
Arhgap8 G T 15: 84,740,766 L46F probably benign Het
Arid1a G A 4: 133,720,857 S115L probably benign Het
B4galnt2 T C 11: 95,868,426 D344G probably damaging Het
BC005561 T C 5: 104,521,002 I1130T possibly damaging Het
Ccdc40 T C 11: 119,231,788 S139P probably benign Het
Ccnjl T C 11: 43,583,228 V210A possibly damaging Het
Cdk5rap1 C T 2: 154,370,956 probably null Het
Cog4 T C 8: 110,866,610 V451A probably damaging Het
Crb1 A T 1: 139,243,014 N818K probably damaging Het
Crtc1 T C 8: 70,402,514 D152G probably damaging Het
Cse1l T A 2: 166,926,403 I207N possibly damaging Het
Cux1 TGGCAGGCGCG TG 5: 136,274,961 probably benign Het
Cyp2j13 T C 4: 96,058,998 Y272C possibly damaging Het
Cyp4f16 T C 17: 32,550,750 F445L possibly damaging Het
Ecm2 A T 13: 49,531,345 I643F probably damaging Het
Eogt A T 6: 97,120,147 probably benign Het
Fbxo41 A C 6: 85,475,194 S777A probably benign Het
Fga T A 3: 83,028,644 D59E probably benign Het
Flt3 A T 5: 147,334,440 V897D probably damaging Het
Fmn1 G T 2: 113,584,120 probably null Het
Frem3 T C 8: 80,613,283 L735P probably damaging Het
Ftmt A T 18: 52,332,053 D147V possibly damaging Het
Gabpa T A 16: 84,857,468 D344E probably benign Het
Gm4788 A T 1: 139,774,475 probably null Het
Gtf3a C T 5: 146,951,913 Q145* probably null Het
Il1f5 A T 2: 24,280,835 N48I probably damaging Het
Iqca A G 1: 90,089,504 L403S probably benign Het
Jrk C T 15: 74,707,220 R72Q probably benign Het
Kif19a G A 11: 114,767,227 M37I probably benign Het
Krt12 T C 11: 99,416,963 D433G possibly damaging Het
Lce1h A T 3: 92,763,463 S127R unknown Het
Lrrc7 T G 3: 158,161,005 Y1033S probably damaging Het
Macf1 A G 4: 123,472,200 S1358P probably damaging Het
Mfsd1 T A 3: 67,587,987 probably null Het
Mki67 T C 7: 135,699,856 T1150A probably damaging Het
Nadk2 A G 15: 9,098,857 I291M possibly damaging Het
Olfr309 T C 7: 86,306,283 T277A probably benign Het
Olfr340 A C 2: 36,453,199 M205L probably benign Het
Olfr456 A G 6: 42,487,097 V32A probably benign Het
Olfr49 T A 14: 54,282,629 T89S probably benign Het
Olfr829 A T 9: 18,857,566 I305F probably benign Het
Parp14 T A 16: 35,857,327 Y757F probably benign Het
Pcdh18 T C 3: 49,754,664 Y734C probably damaging Het
Pcnx4 T C 12: 72,573,952 S849P probably benign Het
Pds5a T C 5: 65,644,120 K595E probably damaging Het
Prkg2 T A 5: 99,024,709 Y49F probably benign Het
Ptgdr G T 14: 44,858,796 P153Q probably damaging Het
Rbm12b2 T C 4: 12,094,805 S555P probably damaging Het
Rhog T G 7: 102,240,150 Y32S probably damaging Het
Rnf141 T C 7: 110,816,768 T209A probably damaging Het
Rtkn2 T C 10: 68,001,927 I103T probably damaging Het
Scn5a G T 9: 119,550,671 C182* probably null Het
Sema3a A G 5: 13,451,241 N84D probably benign Het
Sema5a G T 15: 32,550,290 M158I possibly damaging Het
Shprh T A 10: 11,164,557 D71E probably benign Het
Slc26a8 A G 17: 28,663,634 I239T probably benign Het
Slco4c1 G A 1: 96,841,228 P303L probably damaging Het
Ston1 C T 17: 88,635,694 A176V probably damaging Het
Sult2a5 T C 7: 13,624,051 S3P probably benign Het
Tango6 T A 8: 106,818,526 V1007E probably damaging Het
Tank G A 2: 61,578,635 probably benign Het
Tas2r124 A G 6: 132,755,193 Y155C probably damaging Het
Tenm3 G A 8: 48,235,821 R2244W probably damaging Het
Tlk1 A T 2: 70,721,571 Y585* probably null Het
Tmem221 C T 8: 71,555,140 E214K probably benign Het
Tmem38a T C 8: 72,581,233 V172A possibly damaging Het
Tspo2 C T 17: 48,448,677 A146T possibly damaging Het
Ttc3 G A 16: 94,454,515 A1268T probably damaging Het
Usp25 T A 16: 77,050,467 D154E probably damaging Het
Usp34 T C 11: 23,451,999 F2410L probably benign Het
Vmn1r128 T A 7: 21,350,014 H214Q possibly damaging Het
Vmn1r24 A C 6: 57,956,436 C32W probably damaging Het
Zfp931 T A 2: 178,068,062 H177L probably damaging Het
Znrf1 T C 8: 111,537,566 probably null Het
Other mutations in Dlc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Dlc1 APN 8 36570282 utr 3 prime probably benign
IGL00807:Dlc1 APN 8 36572848 missense probably benign 0.01
IGL00924:Dlc1 APN 8 36938214 missense probably benign
IGL01349:Dlc1 APN 8 36583824 missense probably damaging 0.96
IGL01419:Dlc1 APN 8 36850217 missense probably benign 0.02
IGL01871:Dlc1 APN 8 36850180 missense probably damaging 0.99
IGL01937:Dlc1 APN 8 36850191 missense probably benign 0.25
IGL02525:Dlc1 APN 8 36579646 missense probably damaging 1.00
IGL02696:Dlc1 APN 8 36574172 missense possibly damaging 0.65
IGL02826:Dlc1 APN 8 36570275 utr 3 prime probably benign
IGL03029:Dlc1 APN 8 36571262 splice site probably null
IGL02835:Dlc1 UTSW 8 36583901 missense probably damaging 1.00
R0068:Dlc1 UTSW 8 36937721 missense probably benign
R0068:Dlc1 UTSW 8 36937721 missense probably benign
R0164:Dlc1 UTSW 8 36599440 missense probably damaging 0.96
R0164:Dlc1 UTSW 8 36599440 missense probably damaging 0.96
R0218:Dlc1 UTSW 8 36850229 missense probably benign
R0419:Dlc1 UTSW 8 36583586 missense possibly damaging 0.69
R0513:Dlc1 UTSW 8 36584010 missense probably damaging 1.00
R0645:Dlc1 UTSW 8 36574049 missense possibly damaging 0.60
R0646:Dlc1 UTSW 8 36858051 missense probably benign
R0727:Dlc1 UTSW 8 36572674 missense probably damaging 0.99
R0792:Dlc1 UTSW 8 36938548 missense probably benign 0.00
R1061:Dlc1 UTSW 8 36858051 missense probably benign
R1221:Dlc1 UTSW 8 36584831 missense probably benign
R1440:Dlc1 UTSW 8 36593463 splice site probably benign
R1501:Dlc1 UTSW 8 36938148 missense probably benign 0.06
R1606:Dlc1 UTSW 8 36850252 missense probably benign
R1707:Dlc1 UTSW 8 36937609 missense probably benign 0.03
R1750:Dlc1 UTSW 8 36858090 splice site probably null
R1762:Dlc1 UTSW 8 36937585 missense probably benign 0.25
R2041:Dlc1 UTSW 8 36582768 missense probably damaging 1.00
R2055:Dlc1 UTSW 8 36593381 missense probably damaging 0.98
R2091:Dlc1 UTSW 8 36937609 missense probably benign 0.00
R2987:Dlc1 UTSW 8 36574152 missense probably damaging 0.97
R4285:Dlc1 UTSW 8 36574128 missense possibly damaging 0.49
R4294:Dlc1 UTSW 8 36584753 missense possibly damaging 0.47
R4631:Dlc1 UTSW 8 36937558 critical splice donor site probably null
R4828:Dlc1 UTSW 8 36850246 missense possibly damaging 0.69
R4902:Dlc1 UTSW 8 36577131 missense probably damaging 1.00
R5067:Dlc1 UTSW 8 36584493 missense probably benign 0.04
R5068:Dlc1 UTSW 8 36938030 missense probably benign
R5198:Dlc1 UTSW 8 36938398 missense probably damaging 1.00
R5471:Dlc1 UTSW 8 36584725 missense probably benign 0.26
R5668:Dlc1 UTSW 8 36937501 unclassified probably benign
R5915:Dlc1 UTSW 8 36938675 utr 5 prime probably benign
R6323:Dlc1 UTSW 8 36938383 missense possibly damaging 0.62
R6655:Dlc1 UTSW 8 36572716 missense probably damaging 1.00
R6908:Dlc1 UTSW 8 36937687 missense probably benign 0.02
R6914:Dlc1 UTSW 8 36938210 missense probably benign
R6942:Dlc1 UTSW 8 36938210 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGGGAGCACTGATGATCAAC -3'
(R):5'- CCCAGACAACTCTCGTTTGC -3'

Sequencing Primer
(F):5'- TGATGATCAACCCCAGCTTGG -3'
(R):5'- AACTCTCGTTTGCAAAGCG -3'
Posted On2016-03-17