Incidental Mutation 'R4867:Scn5a'
ID376248
Institutional Source Beutler Lab
Gene Symbol Scn5a
Ensembl Gene ENSMUSG00000032511
Gene Namesodium channel, voltage-gated, type V, alpha
SynonymsNav1.5c, Nav1.5, mH1, SkM2
MMRRC Submission 042477-MU
Accession Numbers

Ncbi RefSeq: NM_021544.4, NM_001253860.1; MGI:98251

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4867 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location119483408-119579016 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 119550671 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 182 (C182*)
Ref Sequence ENSEMBL: ENSMUSP00000113272 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065196] [ENSMUST00000117911] [ENSMUST00000120420]
Predicted Effect probably null
Transcript: ENSMUST00000065196
AA Change: C182*
SMART Domains Protein: ENSMUSP00000066228
Gene: ENSMUSG00000032511
AA Change: C182*

DomainStartEndE-ValueType
Pfam:Ion_trans 130 423 2.4e-82 PFAM
Pfam:Na_trans_cytopl 478 667 5.2e-49 PFAM
Pfam:Ion_trans 716 950 1.1e-54 PFAM
Pfam:Na_trans_assoc 955 1203 2.9e-57 PFAM
Pfam:Ion_trans 1207 1484 2e-66 PFAM
Pfam:Ion_trans 1530 1786 7.2e-55 PFAM
Pfam:PKD_channel 1627 1780 3.5e-7 PFAM
IQ 1903 1925 5e-2 SMART
low complexity region 1961 1983 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000117911
AA Change: C182*
SMART Domains Protein: ENSMUSP00000112838
Gene: ENSMUSG00000032511
AA Change: C182*

DomainStartEndE-ValueType
Pfam:Ion_trans 159 412 9.6e-76 PFAM
coiled coil region 413 451 N/A INTRINSIC
Pfam:DUF3451 461 668 4.9e-44 PFAM
Pfam:Ion_trans 751 940 2.3e-46 PFAM
Pfam:Na_trans_assoc 955 1218 1.2e-73 PFAM
Pfam:Ion_trans 1244 1472 2e-56 PFAM
PDB:1BYY|A 1474 1526 5e-29 PDB
Pfam:Ion_trans 1565 1774 1.5e-49 PFAM
Pfam:PKD_channel 1627 1781 2.6e-10 PFAM
IQ 1903 1925 5e-2 SMART
low complexity region 1961 1983 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000120420
AA Change: C182*
SMART Domains Protein: ENSMUSP00000113272
Gene: ENSMUSG00000032511
AA Change: C182*

DomainStartEndE-ValueType
Pfam:Ion_trans 159 412 4.5e-75 PFAM
coiled coil region 413 451 N/A INTRINSIC
Pfam:DUF3451 461 668 7.4e-43 PFAM
Pfam:Ion_trans 751 940 1.2e-45 PFAM
Pfam:Na_trans_assoc 955 1217 1.6e-72 PFAM
Pfam:Ion_trans 1243 1471 1.1e-55 PFAM
PDB:1BYY|A 1473 1525 5e-29 PDB
Pfam:Ion_trans 1564 1773 8.2e-49 PFAM
Pfam:PKD_channel 1626 1780 2.6e-9 PFAM
IQ 1902 1924 5e-2 SMART
low complexity region 1960 1982 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype Strain: 2179753; 3765977
Lethality: E10-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an integral membrane protein and tetrodotoxin-resistant voltage-gated sodium channel subunit. This protein is found primarily in cardiac muscle and is responsible for the initial upstroke of the action potential in an electrocardiogram. Defects in this gene are a cause of long QT syndrome type 3 (LQT3), an autosomal dominant cardiac disease. Alternative splicing results in several transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for mutations in this gene die prenatally usually during organogenesis and may display decreased embryo size and abnormal cardiovascular system physiology. Heterozygous mice typically display abnormal heartbeats and defects in the function of the impulse conduction system. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Targeted(9) Gene trapped(2)

Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022B05Rik T C 8: 124,639,360 I215V probably damaging Het
4921509C19Rik A T 2: 151,472,822 L312* probably null Het
9930111J21Rik1 T A 11: 48,948,548 probably null Het
Abca6 C A 11: 110,202,379 V1023F probably benign Het
Ablim2 C T 5: 35,802,422 R73C possibly damaging Het
Acsbg2 A G 17: 56,862,914 I151T possibly damaging Het
Arhgap8 G T 15: 84,740,766 L46F probably benign Het
Arid1a G A 4: 133,720,857 S115L probably benign Het
B4galnt2 T C 11: 95,868,426 D344G probably damaging Het
BC005561 T C 5: 104,521,002 I1130T possibly damaging Het
Ccdc40 T C 11: 119,231,788 S139P probably benign Het
Ccnjl T C 11: 43,583,228 V210A possibly damaging Het
Cdk5rap1 C T 2: 154,370,956 probably null Het
Cog4 T C 8: 110,866,610 V451A probably damaging Het
Crb1 A T 1: 139,243,014 N818K probably damaging Het
Crtc1 T C 8: 70,402,514 D152G probably damaging Het
Cse1l T A 2: 166,926,403 I207N possibly damaging Het
Cux1 TGGCAGGCGCG TG 5: 136,274,961 probably benign Het
Cyp2j13 T C 4: 96,058,998 Y272C possibly damaging Het
Cyp4f16 T C 17: 32,550,750 F445L possibly damaging Het
Dlc1 T C 8: 36,584,645 H644R probably benign Het
Ecm2 A T 13: 49,531,345 I643F probably damaging Het
Eogt A T 6: 97,120,147 probably benign Het
Fbxo41 A C 6: 85,475,194 S777A probably benign Het
Fga T A 3: 83,028,644 D59E probably benign Het
Flt3 A T 5: 147,334,440 V897D probably damaging Het
Fmn1 G T 2: 113,584,120 probably null Het
Frem3 T C 8: 80,613,283 L735P probably damaging Het
Ftmt A T 18: 52,332,053 D147V possibly damaging Het
Gabpa T A 16: 84,857,468 D344E probably benign Het
Gm4788 A T 1: 139,774,475 probably null Het
Gtf3a C T 5: 146,951,913 Q145* probably null Het
Il1f5 A T 2: 24,280,835 N48I probably damaging Het
Iqca A G 1: 90,089,504 L403S probably benign Het
Jrk C T 15: 74,707,220 R72Q probably benign Het
Kif19a G A 11: 114,767,227 M37I probably benign Het
Krt12 T C 11: 99,416,963 D433G possibly damaging Het
Lce1h A T 3: 92,763,463 S127R unknown Het
Lrrc7 T G 3: 158,161,005 Y1033S probably damaging Het
Macf1 A G 4: 123,472,200 S1358P probably damaging Het
Mfsd1 T A 3: 67,587,987 probably null Het
Mki67 T C 7: 135,699,856 T1150A probably damaging Het
Nadk2 A G 15: 9,098,857 I291M possibly damaging Het
Olfr309 T C 7: 86,306,283 T277A probably benign Het
Olfr340 A C 2: 36,453,199 M205L probably benign Het
Olfr456 A G 6: 42,487,097 V32A probably benign Het
Olfr49 T A 14: 54,282,629 T89S probably benign Het
Olfr829 A T 9: 18,857,566 I305F probably benign Het
Parp14 T A 16: 35,857,327 Y757F probably benign Het
Pcdh18 T C 3: 49,754,664 Y734C probably damaging Het
Pcnx4 T C 12: 72,573,952 S849P probably benign Het
Pds5a T C 5: 65,644,120 K595E probably damaging Het
Prkg2 T A 5: 99,024,709 Y49F probably benign Het
Ptgdr G T 14: 44,858,796 P153Q probably damaging Het
Rbm12b2 T C 4: 12,094,805 S555P probably damaging Het
Rhog T G 7: 102,240,150 Y32S probably damaging Het
Rnf141 T C 7: 110,816,768 T209A probably damaging Het
Rtkn2 T C 10: 68,001,927 I103T probably damaging Het
Sema3a A G 5: 13,451,241 N84D probably benign Het
Sema5a G T 15: 32,550,290 M158I possibly damaging Het
Shprh T A 10: 11,164,557 D71E probably benign Het
Slc26a8 A G 17: 28,663,634 I239T probably benign Het
Slco4c1 G A 1: 96,841,228 P303L probably damaging Het
Ston1 C T 17: 88,635,694 A176V probably damaging Het
Sult2a5 T C 7: 13,624,051 S3P probably benign Het
Tango6 T A 8: 106,818,526 V1007E probably damaging Het
Tank G A 2: 61,578,635 probably benign Het
Tas2r124 A G 6: 132,755,193 Y155C probably damaging Het
Tenm3 G A 8: 48,235,821 R2244W probably damaging Het
Tlk1 A T 2: 70,721,571 Y585* probably null Het
Tmem221 C T 8: 71,555,140 E214K probably benign Het
Tmem38a T C 8: 72,581,233 V172A possibly damaging Het
Tspo2 C T 17: 48,448,677 A146T possibly damaging Het
Ttc3 G A 16: 94,454,515 A1268T probably damaging Het
Usp25 T A 16: 77,050,467 D154E probably damaging Het
Usp34 T C 11: 23,451,999 F2410L probably benign Het
Vmn1r128 T A 7: 21,350,014 H214Q possibly damaging Het
Vmn1r24 A C 6: 57,956,436 C32W probably damaging Het
Zfp931 T A 2: 178,068,062 H177L probably damaging Het
Znrf1 T C 8: 111,537,566 probably null Het
Other mutations in Scn5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Scn5a APN 9 119486224 missense probably damaging 1.00
IGL00480:Scn5a APN 9 119517538 missense possibly damaging 0.73
IGL00542:Scn5a APN 9 119492126 missense probably damaging 1.00
IGL00852:Scn5a APN 9 119537682 missense probably benign 0.26
IGL00895:Scn5a APN 9 119513104 splice site probably null
IGL00905:Scn5a APN 9 119536501 missense probably damaging 1.00
IGL01347:Scn5a APN 9 119562441 nonsense probably null
IGL01396:Scn5a APN 9 119534704 missense probably damaging 0.98
IGL01402:Scn5a APN 9 119486470 missense probably damaging 1.00
IGL01404:Scn5a APN 9 119486470 missense probably damaging 1.00
IGL01487:Scn5a APN 9 119562623 start codon destroyed probably null 0.90
IGL01612:Scn5a APN 9 119486025 missense possibly damaging 0.86
IGL02134:Scn5a APN 9 119485892 missense probably damaging 0.98
IGL02434:Scn5a APN 9 119533793 missense possibly damaging 0.83
IGL02698:Scn5a APN 9 119521097 missense probably damaging 1.00
IGL02717:Scn5a APN 9 119529010 missense probably benign 0.12
IGL02746:Scn5a APN 9 119550637 missense probably damaging 1.00
IGL02951:Scn5a APN 9 119495685 missense probably damaging 1.00
IGL03155:Scn5a APN 9 119512182 missense possibly damaging 0.74
IGL03188:Scn5a APN 9 119522566 missense probably damaging 1.00
IGL03268:Scn5a APN 9 119521231 missense probably damaging 1.00
IGL03287:Scn5a APN 9 119489778 missense probably damaging 1.00
IGL03328:Scn5a APN 9 119537636 missense probably benign 0.12
PIT4142001:Scn5a UTSW 9 119486258 missense probably damaging 1.00
PIT4520001:Scn5a UTSW 9 119534570 missense possibly damaging 0.56
R0026:Scn5a UTSW 9 119522566 missense probably damaging 1.00
R0044:Scn5a UTSW 9 119492047 critical splice donor site probably null
R0044:Scn5a UTSW 9 119492047 critical splice donor site probably null
R0267:Scn5a UTSW 9 119543135 missense probably damaging 0.98
R0313:Scn5a UTSW 9 119534571 missense probably damaging 1.00
R0360:Scn5a UTSW 9 119522599 missense probably damaging 0.99
R0364:Scn5a UTSW 9 119522599 missense probably damaging 0.99
R0369:Scn5a UTSW 9 119533772 missense probably damaging 0.99
R0512:Scn5a UTSW 9 119550658 missense probably damaging 1.00
R0681:Scn5a UTSW 9 119539640 missense probably damaging 0.96
R1163:Scn5a UTSW 9 119533927 missense probably damaging 1.00
R1469:Scn5a UTSW 9 119533661 critical splice donor site probably null
R1469:Scn5a UTSW 9 119533661 critical splice donor site probably null
R1470:Scn5a UTSW 9 119536475 missense possibly damaging 0.82
R1470:Scn5a UTSW 9 119536475 missense possibly damaging 0.82
R1530:Scn5a UTSW 9 119495562 missense probably damaging 1.00
R1532:Scn5a UTSW 9 119533847 missense probably damaging 1.00
R1544:Scn5a UTSW 9 119486633 missense probably damaging 1.00
R1588:Scn5a UTSW 9 119521301 missense probably damaging 1.00
R1597:Scn5a UTSW 9 119562497 missense probably damaging 0.99
R1607:Scn5a UTSW 9 119486092 missense probably damaging 1.00
R1657:Scn5a UTSW 9 119562380 missense probably damaging 1.00
R1664:Scn5a UTSW 9 119521177 missense possibly damaging 0.84
R1785:Scn5a UTSW 9 119521129 missense probably damaging 1.00
R1925:Scn5a UTSW 9 119529019 missense probably benign
R1956:Scn5a UTSW 9 119517413 missense possibly damaging 0.82
R2006:Scn5a UTSW 9 119536480 missense probably damaging 1.00
R2061:Scn5a UTSW 9 119485651 missense probably damaging 0.98
R2083:Scn5a UTSW 9 119492123 missense probably benign 0.45
R2180:Scn5a UTSW 9 119516051 missense probably benign
R2216:Scn5a UTSW 9 119485612 missense probably benign 0.37
R2216:Scn5a UTSW 9 119513085 missense probably benign
R2320:Scn5a UTSW 9 119529956 critical splice donor site probably null
R2377:Scn5a UTSW 9 119539727 missense probably damaging 1.00
R2510:Scn5a UTSW 9 119533685 missense probably benign 0.05
R3113:Scn5a UTSW 9 119485672 missense probably damaging 1.00
R3769:Scn5a UTSW 9 119552076 critical splice acceptor site probably benign
R4133:Scn5a UTSW 9 119486372 missense probably damaging 1.00
R4164:Scn5a UTSW 9 119495778 missense probably damaging 1.00
R4447:Scn5a UTSW 9 119550627 missense probably damaging 1.00
R4635:Scn5a UTSW 9 119528985 missense possibly damaging 0.47
R4734:Scn5a UTSW 9 119539538 missense probably damaging 0.98
R4829:Scn5a UTSW 9 119534707 missense probably benign 0.00
R5055:Scn5a UTSW 9 119522566 missense probably damaging 1.00
R5229:Scn5a UTSW 9 119535976 missense probably damaging 1.00
R5344:Scn5a UTSW 9 119534007 missense probably benign 0.25
R5424:Scn5a UTSW 9 119501734 missense probably damaging 1.00
R5517:Scn5a UTSW 9 119495713 missense probably damaging 1.00
R5526:Scn5a UTSW 9 119521171 missense probably damaging 1.00
R5560:Scn5a UTSW 9 119560286 missense probably damaging 1.00
R5719:Scn5a UTSW 9 119530052 missense possibly damaging 0.91
R5726:Scn5a UTSW 9 119533847 missense probably damaging 1.00
R5800:Scn5a UTSW 9 119501666 missense probably damaging 1.00
R5826:Scn5a UTSW 9 119521333 missense probably damaging 1.00
R6046:Scn5a UTSW 9 119562374 missense probably damaging 1.00
R6101:Scn5a UTSW 9 119522650 missense probably damaging 0.98
R6162:Scn5a UTSW 9 119522555 missense probably damaging 0.98
R6375:Scn5a UTSW 9 119543356 missense probably damaging 1.00
R6378:Scn5a UTSW 9 119486036 missense probably damaging 1.00
R6464:Scn5a UTSW 9 119534580 missense probably damaging 1.00
R6794:Scn5a UTSW 9 119535889 missense probably damaging 0.98
R6799:Scn5a UTSW 9 119495622 missense possibly damaging 0.62
R6850:Scn5a UTSW 9 119501749 missense possibly damaging 0.92
R6858:Scn5a UTSW 9 119492090 missense probably benign 0.11
R6861:Scn5a UTSW 9 119530023 missense probably damaging 1.00
R6875:Scn5a UTSW 9 119486644 missense probably damaging 1.00
R6989:Scn5a UTSW 9 119486329 missense probably damaging 1.00
R7009:Scn5a UTSW 9 119485930 missense probably damaging 1.00
R7064:Scn5a UTSW 9 119489911 missense probably damaging 0.99
R7145:Scn5a UTSW 9 119486371 missense probably damaging 1.00
R7212:Scn5a UTSW 9 119543385 missense possibly damaging 0.94
R7238:Scn5a UTSW 9 119491544 missense possibly damaging 0.73
R7266:Scn5a UTSW 9 119562560 missense probably benign 0.37
X0023:Scn5a UTSW 9 119517769 missense probably damaging 1.00
X0065:Scn5a UTSW 9 119485669 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGCAAGACAGACACTCCTCTG -3'
(R):5'- CCACTGCGATTGATGACTCTG -3'

Sequencing Primer
(F):5'- GACACTCCTCTGTGGCATACTGTG -3'
(R):5'- ATGACTCTGGTGTGAGGAGC -3'
Posted On2016-03-17