Incidental Mutation 'R4867:Jrk'
ID376270
Institutional Source Beutler Lab
Gene Symbol Jrk
Ensembl Gene ENSMUSG00000046380
Gene Namejerky
Synonyms
MMRRC Submission 042477-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R4867 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location74702301-74709535 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 74707220 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 72 (R72Q)
Ref Sequence ENSEMBL: ENSMUSP00000051842 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050234]
Predicted Effect probably benign
Transcript: ENSMUST00000050234
AA Change: R72Q

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000051842
Gene: ENSMUSG00000046380
AA Change: R72Q

DomainStartEndE-ValueType
Pfam:CENP-B_N 14 66 5.3e-27 PFAM
CENPB 83 149 8.82e-24 SMART
Pfam:DDE_1 213 382 2.2e-46 PFAM
low complexity region 395 405 N/A INTRINSIC
low complexity region 468 481 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000056711
SMART Domains Protein: ENSMUSP00000060582
Gene: ENSMUSG00000044276

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185751
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a conserved protein that is similar to DNA-binding proteins, such as major centromere autoantigen B (CENPB). Inactivation of the related gene in mice resulted in epileptic seizures. Childhood Absence Epilepsy (CAE) has been mapped to the same chromosomal location (8q24.3) as this gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Heterozygous mutants show whole body jerks, clonic seizures and epileptic brain activity. Homozygous mutants show elevated seizure susceptibility, impaired postnatal growth, reduced life span, male sterility and impaired female fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022B05Rik T C 8: 124,639,360 I215V probably damaging Het
4921509C19Rik A T 2: 151,472,822 L312* probably null Het
9930111J21Rik1 T A 11: 48,948,548 probably null Het
Abca6 C A 11: 110,202,379 V1023F probably benign Het
Ablim2 C T 5: 35,802,422 R73C possibly damaging Het
Acsbg2 A G 17: 56,862,914 I151T possibly damaging Het
Arhgap8 G T 15: 84,740,766 L46F probably benign Het
Arid1a G A 4: 133,720,857 S115L probably benign Het
B4galnt2 T C 11: 95,868,426 D344G probably damaging Het
BC005561 T C 5: 104,521,002 I1130T possibly damaging Het
Ccdc40 T C 11: 119,231,788 S139P probably benign Het
Ccnjl T C 11: 43,583,228 V210A possibly damaging Het
Cdk5rap1 C T 2: 154,370,956 probably null Het
Cog4 T C 8: 110,866,610 V451A probably damaging Het
Crb1 A T 1: 139,243,014 N818K probably damaging Het
Crtc1 T C 8: 70,402,514 D152G probably damaging Het
Cse1l T A 2: 166,926,403 I207N possibly damaging Het
Cux1 TGGCAGGCGCG TG 5: 136,274,961 probably benign Het
Cyp2j13 T C 4: 96,058,998 Y272C possibly damaging Het
Cyp4f16 T C 17: 32,550,750 F445L possibly damaging Het
Dlc1 T C 8: 36,584,645 H644R probably benign Het
Ecm2 A T 13: 49,531,345 I643F probably damaging Het
Eogt A T 6: 97,120,147 probably benign Het
Fbxo41 A C 6: 85,475,194 S777A probably benign Het
Fga T A 3: 83,028,644 D59E probably benign Het
Flt3 A T 5: 147,334,440 V897D probably damaging Het
Fmn1 G T 2: 113,584,120 probably null Het
Frem3 T C 8: 80,613,283 L735P probably damaging Het
Ftmt A T 18: 52,332,053 D147V possibly damaging Het
Gabpa T A 16: 84,857,468 D344E probably benign Het
Gm4788 A T 1: 139,774,475 probably null Het
Gtf3a C T 5: 146,951,913 Q145* probably null Het
Il1f5 A T 2: 24,280,835 N48I probably damaging Het
Iqca A G 1: 90,089,504 L403S probably benign Het
Kif19a G A 11: 114,767,227 M37I probably benign Het
Krt12 T C 11: 99,416,963 D433G possibly damaging Het
Lce1h A T 3: 92,763,463 S127R unknown Het
Lrrc7 T G 3: 158,161,005 Y1033S probably damaging Het
Macf1 A G 4: 123,472,200 S1358P probably damaging Het
Mfsd1 T A 3: 67,587,987 probably null Het
Mki67 T C 7: 135,699,856 T1150A probably damaging Het
Nadk2 A G 15: 9,098,857 I291M possibly damaging Het
Olfr309 T C 7: 86,306,283 T277A probably benign Het
Olfr340 A C 2: 36,453,199 M205L probably benign Het
Olfr456 A G 6: 42,487,097 V32A probably benign Het
Olfr49 T A 14: 54,282,629 T89S probably benign Het
Olfr829 A T 9: 18,857,566 I305F probably benign Het
Parp14 T A 16: 35,857,327 Y757F probably benign Het
Pcdh18 T C 3: 49,754,664 Y734C probably damaging Het
Pcnx4 T C 12: 72,573,952 S849P probably benign Het
Pds5a T C 5: 65,644,120 K595E probably damaging Het
Prkg2 T A 5: 99,024,709 Y49F probably benign Het
Ptgdr G T 14: 44,858,796 P153Q probably damaging Het
Rbm12b2 T C 4: 12,094,805 S555P probably damaging Het
Rhog T G 7: 102,240,150 Y32S probably damaging Het
Rnf141 T C 7: 110,816,768 T209A probably damaging Het
Rtkn2 T C 10: 68,001,927 I103T probably damaging Het
Scn5a G T 9: 119,550,671 C182* probably null Het
Sema3a A G 5: 13,451,241 N84D probably benign Het
Sema5a G T 15: 32,550,290 M158I possibly damaging Het
Shprh T A 10: 11,164,557 D71E probably benign Het
Slc26a8 A G 17: 28,663,634 I239T probably benign Het
Slco4c1 G A 1: 96,841,228 P303L probably damaging Het
Ston1 C T 17: 88,635,694 A176V probably damaging Het
Sult2a5 T C 7: 13,624,051 S3P probably benign Het
Tango6 T A 8: 106,818,526 V1007E probably damaging Het
Tank G A 2: 61,578,635 probably benign Het
Tas2r124 A G 6: 132,755,193 Y155C probably damaging Het
Tenm3 G A 8: 48,235,821 R2244W probably damaging Het
Tlk1 A T 2: 70,721,571 Y585* probably null Het
Tmem221 C T 8: 71,555,140 E214K probably benign Het
Tmem38a T C 8: 72,581,233 V172A possibly damaging Het
Tspo2 C T 17: 48,448,677 A146T possibly damaging Het
Ttc3 G A 16: 94,454,515 A1268T probably damaging Het
Usp25 T A 16: 77,050,467 D154E probably damaging Het
Usp34 T C 11: 23,451,999 F2410L probably benign Het
Vmn1r128 T A 7: 21,350,014 H214Q possibly damaging Het
Vmn1r24 A C 6: 57,956,436 C32W probably damaging Het
Zfp931 T A 2: 178,068,062 H177L probably damaging Het
Znrf1 T C 8: 111,537,566 probably null Het
Other mutations in Jrk
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0144:Jrk UTSW 15 74706156 missense probably benign 0.01
R1871:Jrk UTSW 15 74706563 missense possibly damaging 0.91
R3417:Jrk UTSW 15 74706885 missense probably damaging 0.96
R5294:Jrk UTSW 15 74707336 missense possibly damaging 0.88
R5769:Jrk UTSW 15 74706068 missense probably benign 0.19
R5911:Jrk UTSW 15 74705768 missense possibly damaging 0.88
R6123:Jrk UTSW 15 74706680 missense possibly damaging 0.46
R6176:Jrk UTSW 15 74706340 missense possibly damaging 0.47
R7411:Jrk UTSW 15 74707199 missense possibly damaging 0.47
R7480:Jrk UTSW 15 74707053 missense probably benign 0.16
Z1088:Jrk UTSW 15 74707394 missense unknown
Predicted Primers PCR Primer
(F):5'- AGAGAACACACAGGGCTCTG -3'
(R):5'- ACTTAAGCCTGGGATCAGTTC -3'

Sequencing Primer
(F):5'- GTCAGCCGCATCTGCTTGTAG -3'
(R):5'- TCCTCATGGCCTCCAAGCAG -3'
Posted On2016-03-17