Incidental Mutation 'R4868:Slc5a4a'
ID376339
Institutional Source Beutler Lab
Gene Symbol Slc5a4a
Ensembl Gene ENSMUSG00000020229
Gene Namesolute carrier family 5, member 4a
Synonyms
MMRRC Submission 042478-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock #R4868 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location76147451-76189265 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 76178231 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 424 (I424T)
Ref Sequence ENSEMBL: ENSMUSP00000020450 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020450]
Predicted Effect probably damaging
Transcript: ENSMUST00000020450
AA Change: I424T

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000020450
Gene: ENSMUSG00000020229
AA Change: I424T

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
Pfam:SSF 58 492 4e-161 PFAM
transmembrane domain 526 548 N/A INTRINSIC
transmembrane domain 636 655 N/A INTRINSIC
Meta Mutation Damage Score 0.136 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 99% (91/92)
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik A G 8: 105,710,097 *299W probably null Het
4933412E24Rik G A 15: 60,015,968 L208F possibly damaging Het
Abca8b G A 11: 109,974,512 A373V probably benign Het
Actn3 A T 19: 4,864,454 W549R probably benign Het
Adamts4 C T 1: 171,252,431 probably benign Het
Adcy4 T C 14: 55,773,722 I615V probably benign Het
Akap1 A G 11: 88,844,553 S428P possibly damaging Het
Akap13 A T 7: 75,743,504 R2476W probably damaging Het
Alx3 A G 3: 107,600,627 S151G possibly damaging Het
Aoah T A 13: 20,914,981 Y243* probably null Het
Asap1 A G 15: 64,094,181 V1025A probably benign Het
Atp8b1 A T 18: 64,551,866 I728N probably damaging Het
Baz2b C A 2: 59,924,882 V1001L possibly damaging Het
Bmpr2 T A 1: 59,870,456 S1030T probably benign Het
Cacna2d3 A T 14: 28,956,786 probably null Het
Casp3 A T 8: 46,634,279 N87I probably benign Het
Ccdc171 T A 4: 83,694,332 L995Q probably damaging Het
Ccdc80 T A 16: 45,104,413 Y637N probably damaging Het
Ccr4 A G 9: 114,492,833 F55L probably benign Het
Cmah T A 13: 24,464,264 V494E probably damaging Het
Cnot6l A G 5: 96,083,023 Y362H probably damaging Het
Coq6 T C 12: 84,370,952 V222A probably damaging Het
Ctdspl2 C A 2: 121,993,398 T240N possibly damaging Het
D430041D05Rik T C 2: 104,255,409 T248A possibly damaging Het
Dctn6 A T 8: 34,092,076 probably benign Het
Dhx34 T C 7: 16,199,802 D955G probably benign Het
Dnaaf5 A G 5: 139,170,186 M541V probably benign Het
Dnah17 A T 11: 118,108,212 S912T probably benign Het
Dnah2 A T 11: 69,463,648 V2248E probably damaging Het
Dysf T C 6: 84,179,693 W1502R probably damaging Het
Dzip1 A T 14: 118,877,214 V843E probably damaging Het
Esp23 G T 17: 39,074,024 T27K probably benign Het
Esp3 A T 17: 40,633,529 M21L possibly damaging Het
Fam43b T A 4: 138,395,797 T71S probably benign Het
Fam46b A G 4: 133,486,082 probably null Het
Fpgs G A 2: 32,692,661 R63C probably damaging Het
H2-M11 G T 17: 36,548,919 W268L probably damaging Het
Inpp5b T C 4: 124,751,410 S210P probably damaging Het
Itsn1 T A 16: 91,785,317 S51T probably damaging Het
Kctd2 G A 11: 115,429,379 V246I probably damaging Het
Krt75 C T 15: 101,568,121 G403E probably damaging Het
Lamp3 T A 16: 19,701,290 T48S probably benign Het
Lyzl4 C A 9: 121,583,009 V114L probably damaging Het
Maml3 C A 3: 52,103,924 E74* probably null Het
Map2k7 G A 8: 4,247,751 probably benign Het
Mapk8ip3 A G 17: 24,901,415 V883A probably benign Het
Mbtps1 C T 8: 119,508,928 V1004I probably benign Het
Metap1 G T 3: 138,483,089 H48Q probably damaging Het
Mical2 T A 7: 112,318,624 V396E probably damaging Het
Mks1 T A 11: 87,853,723 probably benign Het
Ndst1 T C 18: 60,695,476 T669A probably benign Het
Obox3 T C 7: 15,627,310 K10R probably damaging Het
Olfr1014 T G 2: 85,776,626 V14G possibly damaging Het
Olfr1318 T A 2: 112,156,571 S207T probably damaging Het
Olfr711 C T 7: 106,971,767 M192I probably benign Het
Opn3 T C 1: 175,663,561 Y302C probably damaging Het
Pdzph1 A T 17: 58,974,756 V177D probably benign Het
Pex5l T A 3: 32,952,490 I577F probably damaging Het
Pmpcb T A 5: 21,748,853 Y366* probably null Het
Prr14l A T 5: 32,829,937 M738K probably benign Het
Prx T C 7: 27,517,579 S641P probably benign Het
Ptchd3 A G 11: 121,831,057 Y252C possibly damaging Het
Reg3a A G 6: 78,381,900 E27G probably damaging Het
Ripor2 A G 13: 24,694,141 T300A possibly damaging Het
Sdf4 T A 4: 156,009,185 S259T probably damaging Het
Sike1 A G 3: 102,997,414 probably null Het
Sis T G 3: 72,943,548 I606L probably benign Het
Slc30a9 T C 5: 67,324,683 I94T probably benign Het
Spx C T 6: 142,416,390 R72* probably null Het
St7 C A 6: 17,819,266 N56K probably damaging Het
Tcte2 C A 17: 13,728,008 G3V probably damaging Het
Tgfb3 T C 12: 86,062,181 D258G probably benign Het
Timeless G T 10: 128,247,361 G659V probably benign Het
Tnn T C 1: 160,130,873 R467G possibly damaging Het
Tor1b T C 2: 30,956,577 probably null Het
Trank1 T A 9: 111,365,641 L911Q probably damaging Het
Ttll2 C T 17: 7,351,599 V310I probably benign Het
Ttyh3 A T 5: 140,629,466 I389N probably damaging Het
Ube3b T C 5: 114,398,427 V216A probably benign Het
Vezf1 T A 11: 88,074,694 V254E probably damaging Het
Vmn1r122 T C 7: 21,133,302 E276G probably benign Het
Vmn1r167 T A 7: 23,504,736 N285I probably benign Het
Vmn2r45 T A 7: 8,481,481 I442F probably benign Het
Vwa8 C A 14: 79,183,082 A1741E probably damaging Het
Wdr20 T A 12: 110,738,234 V69E probably damaging Het
Xkr4 T G 1: 3,216,851 Q372P probably damaging Het
Zcchc11 T C 4: 108,549,220 probably benign Het
Other mutations in Slc5a4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00670:Slc5a4a APN 10 76163733 missense probably damaging 1.00
IGL01725:Slc5a4a APN 10 76181674 missense probably benign 0.00
IGL02629:Slc5a4a APN 10 76147579 missense unknown
IGL02976:Slc5a4a APN 10 76170693 missense possibly damaging 0.67
IGL03255:Slc5a4a APN 10 76150512 missense probably damaging 1.00
IGL03258:Slc5a4a APN 10 76150552 missense possibly damaging 0.81
R0054:Slc5a4a UTSW 10 76178197 missense probably null 0.00
R0244:Slc5a4a UTSW 10 76189152 missense possibly damaging 0.46
R0398:Slc5a4a UTSW 10 76182722 missense possibly damaging 0.46
R0799:Slc5a4a UTSW 10 76176534 missense probably benign 0.00
R1160:Slc5a4a UTSW 10 76178161 missense possibly damaging 0.52
R1471:Slc5a4a UTSW 10 76186528 missense probably damaging 0.99
R1720:Slc5a4a UTSW 10 76189269 unclassified probably null
R1857:Slc5a4a UTSW 10 76166735 missense probably benign 0.27
R1858:Slc5a4a UTSW 10 76166735 missense probably benign 0.27
R1859:Slc5a4a UTSW 10 76166735 missense probably benign 0.27
R1942:Slc5a4a UTSW 10 76147588 missense unknown
R2016:Slc5a4a UTSW 10 76153580 missense probably benign 0.00
R2316:Slc5a4a UTSW 10 76178081 splice site probably null
R3420:Slc5a4a UTSW 10 76176573 missense probably benign 0.00
R3421:Slc5a4a UTSW 10 76176573 missense probably benign 0.00
R3422:Slc5a4a UTSW 10 76176573 missense probably benign 0.00
R3845:Slc5a4a UTSW 10 76189149 missense probably damaging 0.99
R3874:Slc5a4a UTSW 10 76181655 missense probably benign 0.42
R4523:Slc5a4a UTSW 10 76148362 missense probably damaging 0.99
R4537:Slc5a4a UTSW 10 76178095 nonsense probably null
R4538:Slc5a4a UTSW 10 76178095 nonsense probably null
R4755:Slc5a4a UTSW 10 76186564 missense probably benign 0.00
R5135:Slc5a4a UTSW 10 76147594 missense unknown
R5254:Slc5a4a UTSW 10 76182738 nonsense probably null
R6083:Slc5a4a UTSW 10 76147597 missense unknown
R6331:Slc5a4a UTSW 10 76178200 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TAACCAGAGCTTGCTCCCTC -3'
(R):5'- GACATCAAGAGCTGAAGCCC -3'

Sequencing Primer
(F):5'- TCTGACCCCAGGACTGC -3'
(R):5'- CCCCAAGAGTAGATGGTAATCTATC -3'
Posted On2016-03-17