Incidental Mutation 'R4868:Coq6'
ID376350
Institutional Source Beutler Lab
Gene Symbol Coq6
Ensembl Gene ENSMUSG00000021235
Gene Namecoenzyme Q6 monooxygenase
Synonyms5930427M12Rik
MMRRC Submission 042478-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4868 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location84361657-84373796 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 84370952 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 222 (V222A)
Ref Sequence ENSEMBL: ENSMUSP00000115676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021661] [ENSMUST00000021662] [ENSMUST00000072061] [ENSMUST00000110272] [ENSMUST00000110276] [ENSMUST00000110278] [ENSMUST00000120942] [ENSMUST00000152913]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021661
AA Change: V222A

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000021661
Gene: ENSMUSG00000021235
AA Change: V222A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 46 56 N/A INTRINSIC
Pfam:FAD_binding_3 195 328 3.9e-8 PFAM
Pfam:FAD_binding_3 334 435 1.3e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000021662
SMART Domains Protein: ENSMUSP00000021662
Gene: ENSMUSG00000021236

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:GDA1_CD39 41 426 3.5e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072061
SMART Domains Protein: ENSMUSP00000071939
Gene: ENSMUSG00000021236

DomainStartEndE-ValueType
transmembrane domain 27 46 N/A INTRINSIC
Pfam:GDA1_CD39 65 451 1.9e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110272
SMART Domains Protein: ENSMUSP00000105901
Gene: ENSMUSG00000021236

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:GDA1_CD39 41 426 3.5e-76 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110276
AA Change: V222A

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000105905
Gene: ENSMUSG00000021235
AA Change: V222A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 46 56 N/A INTRINSIC
Pfam:FAD_binding_3 195 328 5.1e-8 PFAM
Pfam:FAD_binding_3 334 435 1.7e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110278
AA Change: V222A

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000105907
Gene: ENSMUSG00000021235
AA Change: V222A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 46 56 N/A INTRINSIC
Pfam:FAD_binding_3 195 328 6.8e-8 PFAM
Pfam:FAD_binding_3 334 410 1.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120942
SMART Domains Protein: ENSMUSP00000112516
Gene: ENSMUSG00000021236

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:GDA1_CD39 41 426 3.5e-76 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124257
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126913
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140961
Predicted Effect probably benign
Transcript: ENSMUST00000145522
SMART Domains Protein: ENSMUSP00000117609
Gene: ENSMUSG00000021235

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
SCOP:d1foha5 35 167 2e-6 SMART
PDB:4K22|B 90 156 3e-8 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150391
Predicted Effect probably damaging
Transcript: ENSMUST00000152913
AA Change: V222A

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000115676
Gene: ENSMUSG00000021235
AA Change: V222A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
SCOP:d1foha5 39 269 1e-10 SMART
PDB:4K22|B 94 274 1e-20 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153450
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156592
Meta Mutation Damage Score 0.19 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 99% (91/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the ubiH/COQ6 family. It is an evolutionarily conserved monooxygenase required for the biosynthesis of coenzyme Q10 (or ubiquinone), which is an essential component of the mitochondrial electron transport chain, and one of the most potent lipophilic antioxidants implicated in the protection of cell damage by reactive oxygen species. Knockdown of this gene in mouse and zebrafish results in decreased growth due to increased apoptosis. Mutations in this gene are associated with autosomal recessive coenzyme Q10 deficiency-6 (COQ10D6), which manifests as nephrotic syndrome with sensorineural deafness. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik A G 8: 105,710,097 *299W probably null Het
4933412E24Rik G A 15: 60,015,968 L208F possibly damaging Het
Abca8b G A 11: 109,974,512 A373V probably benign Het
Actn3 A T 19: 4,864,454 W549R probably benign Het
Adamts4 C T 1: 171,252,431 probably benign Het
Adcy4 T C 14: 55,773,722 I615V probably benign Het
Akap1 A G 11: 88,844,553 S428P possibly damaging Het
Akap13 A T 7: 75,743,504 R2476W probably damaging Het
Alx3 A G 3: 107,600,627 S151G possibly damaging Het
Aoah T A 13: 20,914,981 Y243* probably null Het
Asap1 A G 15: 64,094,181 V1025A probably benign Het
Atp8b1 A T 18: 64,551,866 I728N probably damaging Het
Baz2b C A 2: 59,924,882 V1001L possibly damaging Het
Bmpr2 T A 1: 59,870,456 S1030T probably benign Het
Cacna2d3 A T 14: 28,956,786 probably null Het
Casp3 A T 8: 46,634,279 N87I probably benign Het
Ccdc171 T A 4: 83,694,332 L995Q probably damaging Het
Ccdc80 T A 16: 45,104,413 Y637N probably damaging Het
Ccr4 A G 9: 114,492,833 F55L probably benign Het
Cmah T A 13: 24,464,264 V494E probably damaging Het
Cnot6l A G 5: 96,083,023 Y362H probably damaging Het
Ctdspl2 C A 2: 121,993,398 T240N possibly damaging Het
D430041D05Rik T C 2: 104,255,409 T248A possibly damaging Het
Dctn6 A T 8: 34,092,076 probably benign Het
Dhx34 T C 7: 16,199,802 D955G probably benign Het
Dnaaf5 A G 5: 139,170,186 M541V probably benign Het
Dnah17 A T 11: 118,108,212 S912T probably benign Het
Dnah2 A T 11: 69,463,648 V2248E probably damaging Het
Dysf T C 6: 84,179,693 W1502R probably damaging Het
Dzip1 A T 14: 118,877,214 V843E probably damaging Het
Esp23 G T 17: 39,074,024 T27K probably benign Het
Esp3 A T 17: 40,633,529 M21L possibly damaging Het
Fam43b T A 4: 138,395,797 T71S probably benign Het
Fam46b A G 4: 133,486,082 probably null Het
Fpgs G A 2: 32,692,661 R63C probably damaging Het
H2-M11 G T 17: 36,548,919 W268L probably damaging Het
Inpp5b T C 4: 124,751,410 S210P probably damaging Het
Itsn1 T A 16: 91,785,317 S51T probably damaging Het
Kctd2 G A 11: 115,429,379 V246I probably damaging Het
Krt75 C T 15: 101,568,121 G403E probably damaging Het
Lamp3 T A 16: 19,701,290 T48S probably benign Het
Lyzl4 C A 9: 121,583,009 V114L probably damaging Het
Maml3 C A 3: 52,103,924 E74* probably null Het
Map2k7 G A 8: 4,247,751 probably benign Het
Mapk8ip3 A G 17: 24,901,415 V883A probably benign Het
Mbtps1 C T 8: 119,508,928 V1004I probably benign Het
Metap1 G T 3: 138,483,089 H48Q probably damaging Het
Mical2 T A 7: 112,318,624 V396E probably damaging Het
Mks1 T A 11: 87,853,723 probably benign Het
Ndst1 T C 18: 60,695,476 T669A probably benign Het
Obox3 T C 7: 15,627,310 K10R probably damaging Het
Olfr1014 T G 2: 85,776,626 V14G possibly damaging Het
Olfr1318 T A 2: 112,156,571 S207T probably damaging Het
Olfr711 C T 7: 106,971,767 M192I probably benign Het
Opn3 T C 1: 175,663,561 Y302C probably damaging Het
Pdzph1 A T 17: 58,974,756 V177D probably benign Het
Pex5l T A 3: 32,952,490 I577F probably damaging Het
Pmpcb T A 5: 21,748,853 Y366* probably null Het
Prr14l A T 5: 32,829,937 M738K probably benign Het
Prx T C 7: 27,517,579 S641P probably benign Het
Ptchd3 A G 11: 121,831,057 Y252C possibly damaging Het
Reg3a A G 6: 78,381,900 E27G probably damaging Het
Ripor2 A G 13: 24,694,141 T300A possibly damaging Het
Sdf4 T A 4: 156,009,185 S259T probably damaging Het
Sike1 A G 3: 102,997,414 probably null Het
Sis T G 3: 72,943,548 I606L probably benign Het
Slc30a9 T C 5: 67,324,683 I94T probably benign Het
Slc5a4a T C 10: 76,178,231 I424T probably damaging Het
Spx C T 6: 142,416,390 R72* probably null Het
St7 C A 6: 17,819,266 N56K probably damaging Het
Tcte2 C A 17: 13,728,008 G3V probably damaging Het
Tgfb3 T C 12: 86,062,181 D258G probably benign Het
Timeless G T 10: 128,247,361 G659V probably benign Het
Tnn T C 1: 160,130,873 R467G possibly damaging Het
Tor1b T C 2: 30,956,577 probably null Het
Trank1 T A 9: 111,365,641 L911Q probably damaging Het
Ttll2 C T 17: 7,351,599 V310I probably benign Het
Ttyh3 A T 5: 140,629,466 I389N probably damaging Het
Ube3b T C 5: 114,398,427 V216A probably benign Het
Vezf1 T A 11: 88,074,694 V254E probably damaging Het
Vmn1r122 T C 7: 21,133,302 E276G probably benign Het
Vmn1r167 T A 7: 23,504,736 N285I probably benign Het
Vmn2r45 T A 7: 8,481,481 I442F probably benign Het
Vwa8 C A 14: 79,183,082 A1741E probably damaging Het
Wdr20 T A 12: 110,738,234 V69E probably damaging Het
Xkr4 T G 1: 3,216,851 Q372P probably damaging Het
Zcchc11 T C 4: 108,549,220 probably benign Het
Other mutations in Coq6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0508:Coq6 UTSW 12 84368139 splice site probably benign
R0607:Coq6 UTSW 12 84368638 missense possibly damaging 0.95
R1221:Coq6 UTSW 12 84371527 missense possibly damaging 0.96
R1885:Coq6 UTSW 12 84372464 missense probably damaging 1.00
R1898:Coq6 UTSW 12 84366963 missense probably benign 0.38
R3153:Coq6 UTSW 12 84371535 missense probably damaging 1.00
R3824:Coq6 UTSW 12 84372415 splice site probably benign
R4015:Coq6 UTSW 12 84366897 missense probably benign 0.00
R4241:Coq6 UTSW 12 84373789 utr 3 prime probably benign
R4285:Coq6 UTSW 12 84370404 intron probably benign
R4353:Coq6 UTSW 12 84368149 missense probably damaging 0.99
R4598:Coq6 UTSW 12 84362139 missense probably benign 0.00
R4599:Coq6 UTSW 12 84362139 missense probably benign 0.00
R4887:Coq6 UTSW 12 84372296 missense probably damaging 1.00
R5567:Coq6 UTSW 12 84368639 missense probably benign 0.10
R5570:Coq6 UTSW 12 84368639 missense probably benign 0.10
R5715:Coq6 UTSW 12 84366907 missense probably benign 0.10
R6608:Coq6 UTSW 12 84372148 missense probably benign 0.00
R7035:Coq6 UTSW 12 84368641 missense probably damaging 0.99
R7096:Coq6 UTSW 12 84361821 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGTTCAGATAGCCACTTAGTCC -3'
(R):5'- ATCACTTACCGGGAGCAGAG -3'

Sequencing Primer
(F):5'- CAGATAGCCACTTAGTCCTGTTGG -3'
(R):5'- GAAATCTCTGCCAGGCTACATTG -3'
Posted On2016-03-17