Incidental Mutation 'R4869:Tomm34'
ID376387
Institutional Source Beutler Lab
Gene Symbol Tomm34
Ensembl Gene ENSMUSG00000018322
Gene Nametranslocase of outer mitochondrial membrane 34
Synonyms2610100K07Rik, TOM34
MMRRC Submission 042479-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.218) question?
Stock #R4869 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location164053540-164071169 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 164054717 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 270 (A270V)
Ref Sequence ENSEMBL: ENSMUSP00000105010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018466] [ENSMUST00000067715] [ENSMUST00000109384]
Predicted Effect probably damaging
Transcript: ENSMUST00000018466
AA Change: A270V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000018466
Gene: ENSMUSG00000018322
AA Change: A270V

DomainStartEndE-ValueType
TPR 9 42 1.4e1 SMART
TPR 51 84 4.21e-3 SMART
TPR 85 118 2.55e-2 SMART
low complexity region 167 182 N/A INTRINSIC
TPR 193 226 1.56e1 SMART
TPR 227 260 5.51e-7 SMART
TPR 261 294 3.67e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000067715
SMART Domains Protein: ENSMUSP00000096701
Gene: ENSMUSG00000054582

DomainStartEndE-ValueType
RRM 12 85 2.3e-23 SMART
RRM 100 171 1.84e-22 SMART
RRM 192 264 2.31e-28 SMART
RRM 295 366 7.07e-24 SMART
SCOP:d1g9la_ 425 478 1e-6 SMART
PolyA 535 598 8.33e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109384
AA Change: A270V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105010
Gene: ENSMUSG00000018322
AA Change: A270V

DomainStartEndE-ValueType
TPR 9 42 1.73e1 SMART
TPR 51 84 4.21e-3 SMART
TPR 85 118 2.55e-2 SMART
low complexity region 167 182 N/A INTRINSIC
TPR 193 226 1.56e1 SMART
TPR 227 260 5.51e-7 SMART
TPR 261 294 3.67e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126272
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132602
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150523
Meta Mutation Damage Score 0.234 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 99% (102/103)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in the import of precursor proteins into mitochondria. The encoded protein has a chaperone-like activity, binding the mature portion of unfolded proteins and aiding their import into mitochondria. This protein, which is found in the cytoplasm and sometimes associated with the outer mitochondrial membrane, has a weak ATPase activity and contains 6 TPR repeats. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are fertile and males do not display any defects in the testes or in spermatogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik C A 9: 57,254,205 K943N probably damaging Het
Abca13 G A 11: 9,315,434 probably null Het
Ankub1 A G 3: 57,690,330 L73P probably damaging Het
Birc6 A G 17: 74,586,012 I982V probably benign Het
Cabyr G T 18: 12,751,818 *454L probably null Het
Ccdc57 C T 11: 120,903,518 probably null Het
Cd209c A G 8: 3,944,077 F128L probably benign Het
Cdh23 A T 10: 60,376,934 I1566N probably damaging Het
Cdon T C 9: 35,452,904 V106A possibly damaging Het
Cebpa G T 7: 35,119,821 G135C probably damaging Het
Cfap65 A G 1: 74,919,261 S896P probably benign Het
Ciz1 T C 2: 32,364,235 S63P probably damaging Het
Clybl G A 14: 122,384,206 V269M probably damaging Het
Ctnnb1 G T 9: 120,952,994 V358L possibly damaging Het
Cwh43 G T 5: 73,428,673 probably null Het
Cyp2d10 G A 15: 82,403,766 R379C probably benign Het
Dab2ip C A 2: 35,720,037 R727S probably damaging Het
Dmrt1 T A 19: 25,505,855 M1K probably null Het
Dock1 A T 7: 134,734,071 I65F probably damaging Het
Ercc2 T C 7: 19,386,807 V155A probably damaging Het
Exph5 A C 9: 53,376,239 D1540A possibly damaging Het
Fat3 T A 9: 16,377,477 H250L probably damaging Het
Fbxw10 C A 11: 62,862,731 A517E probably damaging Het
Furin A T 7: 80,396,979 N176K probably damaging Het
Gabrb3 A G 7: 57,792,459 probably benign Het
Gabrg2 A T 11: 41,920,404 S305T probably damaging Het
Gas6 G T 8: 13,475,086 S299R possibly damaging Het
Gga3 G T 11: 115,586,285 probably benign Het
Gle1 A G 2: 29,936,020 E37G possibly damaging Het
Gm6614 T C 6: 141,987,766 D431G probably damaging Het
Gm7964 A G 7: 83,756,142 D80G possibly damaging Het
Gne C T 4: 44,055,204 probably null Het
Grid2 G T 6: 64,429,740 G695W probably damaging Het
H2-M10.6 A T 17: 36,812,533 M40L probably benign Het
Hectd4 G T 5: 121,322,672 V905L possibly damaging Het
Isyna1 C A 8: 70,596,762 S441R possibly damaging Het
Kcnh3 C T 15: 99,242,032 S933L probably benign Het
Knl1 T C 2: 119,072,351 I1511T possibly damaging Het
Krt73 T C 15: 101,796,398 E351G probably damaging Het
Lipo4 C T 19: 33,501,553 probably null Het
Llgl1 T A 11: 60,707,210 L360* probably null Het
Map2k5 G A 9: 63,322,243 R169* probably null Het
Muc19 A T 15: 91,897,716 noncoding transcript Het
Muc4 G A 16: 32,754,836 probably benign Het
Myh4 A G 11: 67,252,664 E1074G probably damaging Het
Naip5 C T 13: 100,245,131 G210E probably damaging Het
Nalcn A G 14: 123,599,884 S23P probably benign Het
Nepro T A 16: 44,730,173 M176K probably damaging Het
Nlrp6 G A 7: 140,924,093 C704Y probably damaging Het
Notch1 A G 2: 26,471,179 S1100P probably benign Het
Nrxn3 A G 12: 88,795,582 E133G possibly damaging Het
Parp9 T C 16: 35,956,904 L406S probably damaging Het
Peak1 G T 9: 56,227,592 A155D probably benign Het
Piezo1 G A 8: 122,487,545 H1628Y probably benign Het
Piwil2 A G 14: 70,395,362 V587A probably benign Het
Pkn2 A G 3: 142,803,618 Y722H probably damaging Het
Plch2 A T 4: 154,989,428 I834K probably benign Het
Pld1 A G 3: 28,109,802 T795A possibly damaging Het
Plekhh1 A G 12: 79,050,386 S103G probably benign Het
Ppl T C 16: 5,104,889 Y246C probably damaging Het
Prpf40b G A 15: 99,309,845 probably benign Het
Prr14l A G 5: 32,828,833 L1106P probably damaging Het
Ptbp3 T A 4: 59,524,443 I28F possibly damaging Het
Ptrh2 A T 11: 86,689,805 K83* probably null Het
Rai1 T C 11: 60,186,762 S551P probably damaging Het
Rapgefl1 A T 11: 98,851,109 Q633L probably damaging Het
Rb1cc1 T C 1: 6,215,021 probably benign Het
Rif1 T A 2: 52,093,611 probably benign Het
Rnf141 A G 7: 110,825,350 Y101H probably damaging Het
Rnf219 A G 14: 104,478,816 I707T probably damaging Het
Rttn T A 18: 89,043,014 L1102* probably null Het
Sall4 G A 2: 168,755,717 S401F probably damaging Het
Sec11c T C 18: 65,801,470 I36T probably benign Het
Sel1l A G 12: 91,814,054 probably benign Het
Setd1a T C 7: 127,797,604 probably benign Het
Sez6l2 C T 7: 126,961,842 P433L probably benign Het
Sgf29 T C 7: 126,649,375 probably benign Het
Slc47a1 A G 11: 61,362,694 V305A probably benign Het
Sun2 T C 15: 79,728,386 probably benign Het
Tecta T C 9: 42,375,534 S609G probably benign Het
Tex45 G A 8: 3,487,148 S498N probably damaging Het
Tmprss6 T A 15: 78,443,680 probably null Het
Tns1 T C 1: 73,952,615 H968R probably benign Het
Tpo T C 12: 30,103,365 K330R probably benign Het
Ttn T A 2: 76,712,493 Y33383F probably damaging Het
Unc13c G T 9: 73,680,434 A1439D probably benign Het
Vcp C T 4: 42,993,691 R147H probably benign Het
Vps13d A G 4: 145,128,042 L2272P probably damaging Het
Wdfy3 A G 5: 101,894,921 L1988P probably damaging Het
Wwc2 A G 8: 47,920,678 F51S probably damaging Het
Zfp454 C T 11: 50,873,153 C373Y probably damaging Het
Zfp853 A T 5: 143,288,293 V473E probably damaging Het
Zfp959 A T 17: 55,897,228 R85S possibly damaging Het
Other mutations in Tomm34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Tomm34 APN 2 164058662 splice site probably benign
IGL02426:Tomm34 APN 2 164064955 missense probably damaging 1.00
R0744:Tomm34 UTSW 2 164070976 missense probably benign 0.34
R1938:Tomm34 UTSW 2 164061006 missense probably benign 0.00
R4506:Tomm34 UTSW 2 164054372 unclassified probably null
R4541:Tomm34 UTSW 2 164054799 missense probably benign 0.03
R5080:Tomm34 UTSW 2 164070896 intron probably benign
R6106:Tomm34 UTSW 2 164060991 missense probably benign
R7037:Tomm34 UTSW 2 164070478 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGGAGGCTGCTGATATCCG -3'
(R):5'- GCACTGAGCAGGTGTTTAGC -3'

Sequencing Primer
(F):5'- GGACCTAGAGGACACAAAAACG -3'
(R):5'- GGTGTTTAGCAAACCAGGTCATTCC -3'
Posted On2016-03-17