Incidental Mutation 'R4869:Gm7964'
ID376408
Institutional Source Beutler Lab
Gene Symbol Gm7964
Ensembl Gene ENSMUSG00000063902
Gene Namepredicted gene 7964
Synonyms
MMRRC Submission 042479-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.906) question?
Stock #R4869 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location83755904-83757356 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 83756142 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 80 (D80G)
Gene Model predicted gene model for transcript(s):
Predicted Effect possibly damaging
Transcript: ENSMUST00000042280
AA Change: D80G

PolyPhen 2 Score 0.508 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000088990
Gene: ENSMUSG00000063902
AA Change: D80G

DomainStartEndE-ValueType
KH 41 109 4.56e-11 SMART
KH 119 190 2.62e-11 SMART
low complexity region 238 253 N/A INTRINSIC
low complexity region 260 276 N/A INTRINSIC
low complexity region 282 290 N/A INTRINSIC
low complexity region 298 310 N/A INTRINSIC
low complexity region 340 356 N/A INTRINSIC
KH 361 431 7.45e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000051522
SMART Domains Protein: ENSMUSP00000095927
Gene: ENSMUSG00000063902

DomainStartEndE-ValueType
KH 41 109 4.56e-11 SMART
KH 143 214 2.62e-11 SMART
low complexity region 262 277 N/A INTRINSIC
low complexity region 284 300 N/A INTRINSIC
low complexity region 306 314 N/A INTRINSIC
low complexity region 322 334 N/A INTRINSIC
low complexity region 364 380 N/A INTRINSIC
KH 385 455 7.45e-16 SMART
Meta Mutation Damage Score 0.062 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 99% (102/103)
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik C A 9: 57,254,205 K943N probably damaging Het
Abca13 G A 11: 9,315,434 probably null Het
Ankub1 A G 3: 57,690,330 L73P probably damaging Het
Birc6 A G 17: 74,586,012 I982V probably benign Het
Cabyr G T 18: 12,751,818 *454L probably null Het
Ccdc57 C T 11: 120,903,518 probably null Het
Cd209c A G 8: 3,944,077 F128L probably benign Het
Cdh23 A T 10: 60,376,934 I1566N probably damaging Het
Cdon T C 9: 35,452,904 V106A possibly damaging Het
Cebpa G T 7: 35,119,821 G135C probably damaging Het
Cfap65 A G 1: 74,919,261 S896P probably benign Het
Ciz1 T C 2: 32,364,235 S63P probably damaging Het
Clybl G A 14: 122,384,206 V269M probably damaging Het
Ctnnb1 G T 9: 120,952,994 V358L possibly damaging Het
Cwh43 G T 5: 73,428,673 probably null Het
Cyp2d10 G A 15: 82,403,766 R379C probably benign Het
Dab2ip C A 2: 35,720,037 R727S probably damaging Het
Dmrt1 T A 19: 25,505,855 M1K probably null Het
Dock1 A T 7: 134,734,071 I65F probably damaging Het
Ercc2 T C 7: 19,386,807 V155A probably damaging Het
Exph5 A C 9: 53,376,239 D1540A possibly damaging Het
Fat3 T A 9: 16,377,477 H250L probably damaging Het
Fbxw10 C A 11: 62,862,731 A517E probably damaging Het
Furin A T 7: 80,396,979 N176K probably damaging Het
Gabrb3 A G 7: 57,792,459 probably benign Het
Gabrg2 A T 11: 41,920,404 S305T probably damaging Het
Gas6 G T 8: 13,475,086 S299R possibly damaging Het
Gga3 G T 11: 115,586,285 probably benign Het
Gle1 A G 2: 29,936,020 E37G possibly damaging Het
Gm6614 T C 6: 141,987,766 D431G probably damaging Het
Gne C T 4: 44,055,204 probably null Het
Grid2 G T 6: 64,429,740 G695W probably damaging Het
H2-M10.6 A T 17: 36,812,533 M40L probably benign Het
Hectd4 G T 5: 121,322,672 V905L possibly damaging Het
Isyna1 C A 8: 70,596,762 S441R possibly damaging Het
Kcnh3 C T 15: 99,242,032 S933L probably benign Het
Knl1 T C 2: 119,072,351 I1511T possibly damaging Het
Krt73 T C 15: 101,796,398 E351G probably damaging Het
Lipo4 C T 19: 33,501,553 probably null Het
Llgl1 T A 11: 60,707,210 L360* probably null Het
Map2k5 G A 9: 63,322,243 R169* probably null Het
Muc19 A T 15: 91,897,716 noncoding transcript Het
Muc4 G A 16: 32,754,836 probably benign Het
Myh4 A G 11: 67,252,664 E1074G probably damaging Het
Naip5 C T 13: 100,245,131 G210E probably damaging Het
Nalcn A G 14: 123,599,884 S23P probably benign Het
Nepro T A 16: 44,730,173 M176K probably damaging Het
Nlrp6 G A 7: 140,924,093 C704Y probably damaging Het
Notch1 A G 2: 26,471,179 S1100P probably benign Het
Nrxn3 A G 12: 88,795,582 E133G possibly damaging Het
Parp9 T C 16: 35,956,904 L406S probably damaging Het
Peak1 G T 9: 56,227,592 A155D probably benign Het
Piezo1 G A 8: 122,487,545 H1628Y probably benign Het
Piwil2 A G 14: 70,395,362 V587A probably benign Het
Pkn2 A G 3: 142,803,618 Y722H probably damaging Het
Plch2 A T 4: 154,989,428 I834K probably benign Het
Pld1 A G 3: 28,109,802 T795A possibly damaging Het
Plekhh1 A G 12: 79,050,386 S103G probably benign Het
Ppl T C 16: 5,104,889 Y246C probably damaging Het
Prpf40b G A 15: 99,309,845 probably benign Het
Prr14l A G 5: 32,828,833 L1106P probably damaging Het
Ptbp3 T A 4: 59,524,443 I28F possibly damaging Het
Ptrh2 A T 11: 86,689,805 K83* probably null Het
Rai1 T C 11: 60,186,762 S551P probably damaging Het
Rapgefl1 A T 11: 98,851,109 Q633L probably damaging Het
Rb1cc1 T C 1: 6,215,021 probably benign Het
Rif1 T A 2: 52,093,611 probably benign Het
Rnf141 A G 7: 110,825,350 Y101H probably damaging Het
Rnf219 A G 14: 104,478,816 I707T probably damaging Het
Rttn T A 18: 89,043,014 L1102* probably null Het
Sall4 G A 2: 168,755,717 S401F probably damaging Het
Sec11c T C 18: 65,801,470 I36T probably benign Het
Sel1l A G 12: 91,814,054 probably benign Het
Setd1a T C 7: 127,797,604 probably benign Het
Sez6l2 C T 7: 126,961,842 P433L probably benign Het
Sgf29 T C 7: 126,649,375 probably benign Het
Slc47a1 A G 11: 61,362,694 V305A probably benign Het
Sun2 T C 15: 79,728,386 probably benign Het
Tecta T C 9: 42,375,534 S609G probably benign Het
Tex45 G A 8: 3,487,148 S498N probably damaging Het
Tmprss6 T A 15: 78,443,680 probably null Het
Tns1 T C 1: 73,952,615 H968R probably benign Het
Tomm34 G A 2: 164,054,717 A270V probably damaging Het
Tpo T C 12: 30,103,365 K330R probably benign Het
Ttn T A 2: 76,712,493 Y33383F probably damaging Het
Unc13c G T 9: 73,680,434 A1439D probably benign Het
Vcp C T 4: 42,993,691 R147H probably benign Het
Vps13d A G 4: 145,128,042 L2272P probably damaging Het
Wdfy3 A G 5: 101,894,921 L1988P probably damaging Het
Wwc2 A G 8: 47,920,678 F51S probably damaging Het
Zfp454 C T 11: 50,873,153 C373Y probably damaging Het
Zfp853 A T 5: 143,288,293 V473E probably damaging Het
Zfp959 A T 17: 55,897,228 R85S possibly damaging Het
Other mutations in Gm7964
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01665:Gm7964 APN 7 83757133 exon noncoding transcript
IGL01691:Gm7964 APN 7 83756136 exon noncoding transcript
IGL02232:Gm7964 APN 7 83756307 exon noncoding transcript
IGL02525:Gm7964 APN 7 83756042 exon noncoding transcript
R0512:Gm7964 UTSW 7 83755950 exon noncoding transcript
R0543:Gm7964 UTSW 7 83756394 exon noncoding transcript
R0723:Gm7964 UTSW 7 83756166 exon noncoding transcript
R1977:Gm7964 UTSW 7 83757352 missense possibly damaging 0.56
R2397:Gm7964 UTSW 7 83757113 exon noncoding transcript
R3623:Gm7964 UTSW 7 83756421 missense probably benign 0.02
R3769:Gm7964 UTSW 7 83756130 missense probably damaging 0.98
R4222:Gm7964 UTSW 7 83756822 missense probably damaging 1.00
R4224:Gm7964 UTSW 7 83756822 missense probably damaging 1.00
R4796:Gm7964 UTSW 7 83755901 unclassified probably null
R5086:Gm7964 UTSW 7 83757352 missense possibly damaging 0.56
R5944:Gm7964 UTSW 7 83756535 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAATTTGGTAAACGCCCTGCAG -3'
(R):5'- TGAATCAACAGTCTCAACTCGC -3'

Sequencing Primer
(F):5'- CGCCCTGCAGAAGATATGG -3'
(R):5'- GTCTCAACTCGCAATCAAAGTC -3'
Posted On2016-03-17