Incidental Mutation 'R4869:Piezo1'
ID376419
Institutional Source Beutler Lab
Gene Symbol Piezo1
Ensembl Gene ENSMUSG00000014444
Gene Namepiezo-type mechanosensitive ion channel component 1
SynonymsFam38a, Piezo1
MMRRC Submission 042479-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4869 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location122481698-122551329 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 122487545 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 1628 (H1628Y)
Ref Sequence ENSEMBL: ENSMUSP00000089777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067252] [ENSMUST00000116412] [ENSMUST00000127664] [ENSMUST00000128383] [ENSMUST00000151855] [ENSMUST00000156333]
Predicted Effect probably benign
Transcript: ENSMUST00000067252
AA Change: H1628Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000089777
Gene: ENSMUSG00000014444
AA Change: H1628Y

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
transmembrane domain 29 46 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
transmembrane domain 121 143 N/A INTRINSIC
low complexity region 156 169 N/A INTRINSIC
transmembrane domain 211 233 N/A INTRINSIC
transmembrane domain 248 270 N/A INTRINSIC
transmembrane domain 316 333 N/A INTRINSIC
low complexity region 353 368 N/A INTRINSIC
low complexity region 396 408 N/A INTRINSIC
transmembrane domain 433 455 N/A INTRINSIC
transmembrane domain 468 490 N/A INTRINSIC
transmembrane domain 513 535 N/A INTRINSIC
internal_repeat_1 541 658 5.31e-5 PROSPERO
transmembrane domain 685 707 N/A INTRINSIC
low complexity region 738 753 N/A INTRINSIC
transmembrane domain 817 839 N/A INTRINSIC
transmembrane domain 844 866 N/A INTRINSIC
low complexity region 940 952 N/A INTRINSIC
transmembrane domain 979 1001 N/A INTRINSIC
transmembrane domain 1005 1022 N/A INTRINSIC
transmembrane domain 1035 1057 N/A INTRINSIC
transmembrane domain 1154 1171 N/A INTRINSIC
transmembrane domain 1178 1197 N/A INTRINSIC
Pfam:PIEZO 1229 1458 1.1e-97 PFAM
low complexity region 1475 1486 N/A INTRINSIC
internal_repeat_1 1646 1752 5.31e-5 PROSPERO
low complexity region 1905 1921 N/A INTRINSIC
transmembrane domain 1976 1998 N/A INTRINSIC
transmembrane domain 2018 2038 N/A INTRINSIC
transmembrane domain 2045 2067 N/A INTRINSIC
transmembrane domain 2077 2094 N/A INTRINSIC
Pfam:Piezo_RRas_bdg 2126 2544 3.2e-157 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000116412
SMART Domains Protein: ENSMUSP00000112113
Gene: ENSMUSG00000049482

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
SCOP:d1sur__ 47 153 1e-3 SMART
Pfam:CTU2 347 470 2.3e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123671
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126553
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128383
SMART Domains Protein: ENSMUSP00000116194
Gene: ENSMUSG00000014444

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
transmembrane domain 31 53 N/A INTRINSIC
transmembrane domain 75 97 N/A INTRINSIC
transmembrane domain 143 165 N/A INTRINSIC
transmembrane domain 169 188 N/A INTRINSIC
transmembrane domain 195 217 N/A INTRINSIC
transmembrane domain 247 269 N/A INTRINSIC
low complexity region 300 315 N/A INTRINSIC
transmembrane domain 379 401 N/A INTRINSIC
transmembrane domain 406 428 N/A INTRINSIC
low complexity region 502 514 N/A INTRINSIC
transmembrane domain 541 563 N/A INTRINSIC
transmembrane domain 567 584 N/A INTRINSIC
transmembrane domain 597 619 N/A INTRINSIC
transmembrane domain 716 733 N/A INTRINSIC
transmembrane domain 740 759 N/A INTRINSIC
transmembrane domain 774 796 N/A INTRINSIC
transmembrane domain 803 820 N/A INTRINSIC
low complexity region 848 859 N/A INTRINSIC
coiled coil region 895 926 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134304
Predicted Effect unknown
Transcript: ENSMUST00000148497
AA Change: H978Y
SMART Domains Protein: ENSMUSP00000121725
Gene: ENSMUSG00000014444
AA Change: H978Y

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
low complexity region 86 101 N/A INTRINSIC
transmembrane domain 165 187 N/A INTRINSIC
low complexity region 288 300 N/A INTRINSIC
transmembrane domain 351 373 N/A INTRINSIC
transmembrane domain 386 408 N/A INTRINSIC
transmembrane domain 505 522 N/A INTRINSIC
transmembrane domain 529 548 N/A INTRINSIC
Pfam:PIEZO 580 809 3.2e-98 PFAM
low complexity region 826 837 N/A INTRINSIC
low complexity region 1003 1020 N/A INTRINSIC
low complexity region 1046 1063 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151855
SMART Domains Protein: ENSMUSP00000133622
Gene: ENSMUSG00000049482

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
SCOP:d1sur__ 47 153 9e-4 SMART
Pfam:DUF2392 277 377 1.7e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152596
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155803
Predicted Effect unknown
Transcript: ENSMUST00000156333
AA Change: H1629Y
SMART Domains Protein: ENSMUSP00000114584
Gene: ENSMUSG00000014444
AA Change: H1629Y

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
transmembrane domain 29 46 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
transmembrane domain 121 143 N/A INTRINSIC
low complexity region 157 170 N/A INTRINSIC
transmembrane domain 212 234 N/A INTRINSIC
transmembrane domain 249 271 N/A INTRINSIC
transmembrane domain 317 334 N/A INTRINSIC
low complexity region 354 369 N/A INTRINSIC
low complexity region 397 409 N/A INTRINSIC
transmembrane domain 434 456 N/A INTRINSIC
transmembrane domain 469 491 N/A INTRINSIC
transmembrane domain 514 536 N/A INTRINSIC
internal_repeat_1 542 659 4.88e-5 PROSPERO
transmembrane domain 686 708 N/A INTRINSIC
low complexity region 739 754 N/A INTRINSIC
transmembrane domain 818 840 N/A INTRINSIC
transmembrane domain 845 867 N/A INTRINSIC
low complexity region 941 953 N/A INTRINSIC
transmembrane domain 980 1002 N/A INTRINSIC
transmembrane domain 1006 1023 N/A INTRINSIC
transmembrane domain 1036 1058 N/A INTRINSIC
transmembrane domain 1155 1172 N/A INTRINSIC
transmembrane domain 1179 1198 N/A INTRINSIC
Pfam:PIEZO 1230 1459 2.3e-94 PFAM
low complexity region 1476 1487 N/A INTRINSIC
internal_repeat_1 1647 1753 4.88e-5 PROSPERO
low complexity region 1906 1922 N/A INTRINSIC
transmembrane domain 1977 1999 N/A INTRINSIC
transmembrane domain 2019 2039 N/A INTRINSIC
transmembrane domain 2046 2068 N/A INTRINSIC
transmembrane domain 2078 2095 N/A INTRINSIC
Pfam:Piezo_RRas_bdg 2127 2545 8.7e-154 PFAM
Meta Mutation Damage Score 0.122 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 99% (102/103)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a mechanically-activated ion channel that links mechanical forces to biological signals. The encoded protein contains 36 transmembrane domains and functions as a homotetramer. Defects in this gene have been associated with dehydrated hereditary stomatocytosis. [provided by RefSeq, Jul 2015]
PHENOTYPE: Most mice homozygous for a gene trapped allele die at midgestation, exhibiting embryonic growth retardation, pericardial effusion, and vascular remodeling defects in the yolk sac and the embryo proper. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik C A 9: 57,254,205 K943N probably damaging Het
Abca13 G A 11: 9,315,434 probably null Het
Ankub1 A G 3: 57,690,330 L73P probably damaging Het
Birc6 A G 17: 74,586,012 I982V probably benign Het
Cabyr G T 18: 12,751,818 *454L probably null Het
Ccdc57 C T 11: 120,903,518 probably null Het
Cd209c A G 8: 3,944,077 F128L probably benign Het
Cdh23 A T 10: 60,376,934 I1566N probably damaging Het
Cdon T C 9: 35,452,904 V106A possibly damaging Het
Cebpa G T 7: 35,119,821 G135C probably damaging Het
Cfap65 A G 1: 74,919,261 S896P probably benign Het
Ciz1 T C 2: 32,364,235 S63P probably damaging Het
Clybl G A 14: 122,384,206 V269M probably damaging Het
Ctnnb1 G T 9: 120,952,994 V358L possibly damaging Het
Cwh43 G T 5: 73,428,673 probably null Het
Cyp2d10 G A 15: 82,403,766 R379C probably benign Het
Dab2ip C A 2: 35,720,037 R727S probably damaging Het
Dmrt1 T A 19: 25,505,855 M1K probably null Het
Dock1 A T 7: 134,734,071 I65F probably damaging Het
Ercc2 T C 7: 19,386,807 V155A probably damaging Het
Exph5 A C 9: 53,376,239 D1540A possibly damaging Het
Fat3 T A 9: 16,377,477 H250L probably damaging Het
Fbxw10 C A 11: 62,862,731 A517E probably damaging Het
Furin A T 7: 80,396,979 N176K probably damaging Het
Gabrb3 A G 7: 57,792,459 probably benign Het
Gabrg2 A T 11: 41,920,404 S305T probably damaging Het
Gas6 G T 8: 13,475,086 S299R possibly damaging Het
Gga3 G T 11: 115,586,285 probably benign Het
Gle1 A G 2: 29,936,020 E37G possibly damaging Het
Gm6614 T C 6: 141,987,766 D431G probably damaging Het
Gm7964 A G 7: 83,756,142 D80G possibly damaging Het
Gne C T 4: 44,055,204 probably null Het
Grid2 G T 6: 64,429,740 G695W probably damaging Het
H2-M10.6 A T 17: 36,812,533 M40L probably benign Het
Hectd4 G T 5: 121,322,672 V905L possibly damaging Het
Isyna1 C A 8: 70,596,762 S441R possibly damaging Het
Kcnh3 C T 15: 99,242,032 S933L probably benign Het
Knl1 T C 2: 119,072,351 I1511T possibly damaging Het
Krt73 T C 15: 101,796,398 E351G probably damaging Het
Lipo4 C T 19: 33,501,553 probably null Het
Llgl1 T A 11: 60,707,210 L360* probably null Het
Map2k5 G A 9: 63,322,243 R169* probably null Het
Muc19 A T 15: 91,897,716 noncoding transcript Het
Muc4 G A 16: 32,754,836 probably benign Het
Myh4 A G 11: 67,252,664 E1074G probably damaging Het
Naip5 C T 13: 100,245,131 G210E probably damaging Het
Nalcn A G 14: 123,599,884 S23P probably benign Het
Nepro T A 16: 44,730,173 M176K probably damaging Het
Nlrp6 G A 7: 140,924,093 C704Y probably damaging Het
Notch1 A G 2: 26,471,179 S1100P probably benign Het
Nrxn3 A G 12: 88,795,582 E133G possibly damaging Het
Parp9 T C 16: 35,956,904 L406S probably damaging Het
Peak1 G T 9: 56,227,592 A155D probably benign Het
Piwil2 A G 14: 70,395,362 V587A probably benign Het
Pkn2 A G 3: 142,803,618 Y722H probably damaging Het
Plch2 A T 4: 154,989,428 I834K probably benign Het
Pld1 A G 3: 28,109,802 T795A possibly damaging Het
Plekhh1 A G 12: 79,050,386 S103G probably benign Het
Ppl T C 16: 5,104,889 Y246C probably damaging Het
Prpf40b G A 15: 99,309,845 probably benign Het
Prr14l A G 5: 32,828,833 L1106P probably damaging Het
Ptbp3 T A 4: 59,524,443 I28F possibly damaging Het
Ptrh2 A T 11: 86,689,805 K83* probably null Het
Rai1 T C 11: 60,186,762 S551P probably damaging Het
Rapgefl1 A T 11: 98,851,109 Q633L probably damaging Het
Rb1cc1 T C 1: 6,215,021 probably benign Het
Rif1 T A 2: 52,093,611 probably benign Het
Rnf141 A G 7: 110,825,350 Y101H probably damaging Het
Rnf219 A G 14: 104,478,816 I707T probably damaging Het
Rttn T A 18: 89,043,014 L1102* probably null Het
Sall4 G A 2: 168,755,717 S401F probably damaging Het
Sec11c T C 18: 65,801,470 I36T probably benign Het
Sel1l A G 12: 91,814,054 probably benign Het
Setd1a T C 7: 127,797,604 probably benign Het
Sez6l2 C T 7: 126,961,842 P433L probably benign Het
Sgf29 T C 7: 126,649,375 probably benign Het
Slc47a1 A G 11: 61,362,694 V305A probably benign Het
Sun2 T C 15: 79,728,386 probably benign Het
Tecta T C 9: 42,375,534 S609G probably benign Het
Tex45 G A 8: 3,487,148 S498N probably damaging Het
Tmprss6 T A 15: 78,443,680 probably null Het
Tns1 T C 1: 73,952,615 H968R probably benign Het
Tomm34 G A 2: 164,054,717 A270V probably damaging Het
Tpo T C 12: 30,103,365 K330R probably benign Het
Ttn T A 2: 76,712,493 Y33383F probably damaging Het
Unc13c G T 9: 73,680,434 A1439D probably benign Het
Vcp C T 4: 42,993,691 R147H probably benign Het
Vps13d A G 4: 145,128,042 L2272P probably damaging Het
Wdfy3 A G 5: 101,894,921 L1988P probably damaging Het
Wwc2 A G 8: 47,920,678 F51S probably damaging Het
Zfp454 C T 11: 50,873,153 C373Y probably damaging Het
Zfp853 A T 5: 143,288,293 V473E probably damaging Het
Zfp959 A T 17: 55,897,228 R85S possibly damaging Het
Other mutations in Piezo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00896:Piezo1 APN 8 122497870 missense possibly damaging 0.91
IGL01094:Piezo1 APN 8 122482138 missense probably damaging 0.99
IGL01321:Piezo1 APN 8 122487600 missense probably damaging 0.99
IGL01695:Piezo1 APN 8 122495509 missense possibly damaging 0.81
IGL01762:Piezo1 APN 8 122487929 nonsense probably null
IGL01922:Piezo1 APN 8 122492692 missense probably benign 0.41
IGL01953:Piezo1 APN 8 122491184 missense probably damaging 1.00
IGL01997:Piezo1 APN 8 122488331 splice site probably benign
IGL02381:Piezo1 APN 8 122498544 missense probably benign 0.28
IGL02398:Piezo1 APN 8 122486563 missense probably benign 0.21
IGL02562:Piezo1 APN 8 122496763 missense probably benign 0.11
IGL02572:Piezo1 APN 8 122485305 missense probably benign 0.28
IGL02691:Piezo1 APN 8 122501949 missense possibly damaging 0.58
IGL02726:Piezo1 APN 8 122487155 missense probably damaging 0.99
IGL02814:Piezo1 APN 8 122498215 missense probably damaging 1.00
IGL02931:Piezo1 APN 8 122483519 missense probably damaging 1.00
IGL03145:Piezo1 APN 8 122482921 missense probably benign 0.14
FR4449:Piezo1 UTSW 8 122495569 missense probably damaging 1.00
FR4548:Piezo1 UTSW 8 122495569 missense probably damaging 1.00
FR4737:Piezo1 UTSW 8 122495569 missense probably damaging 1.00
FR4976:Piezo1 UTSW 8 122495569 missense probably damaging 1.00
LCD18:Piezo1 UTSW 8 122495569 missense probably damaging 1.00
R0085:Piezo1 UTSW 8 122501615 missense probably damaging 0.98
R0096:Piezo1 UTSW 8 122485370 unclassified probably benign
R0970:Piezo1 UTSW 8 122486810 missense possibly damaging 0.94
R1364:Piezo1 UTSW 8 122498571 missense possibly damaging 0.61
R1460:Piezo1 UTSW 8 122502151 missense possibly damaging 0.86
R1485:Piezo1 UTSW 8 122482049 missense probably damaging 1.00
R1538:Piezo1 UTSW 8 122491403 missense probably damaging 1.00
R1655:Piezo1 UTSW 8 122496822 missense probably benign 0.09
R1700:Piezo1 UTSW 8 122487502 missense probably damaging 1.00
R1860:Piezo1 UTSW 8 122495750 missense possibly damaging 0.90
R1861:Piezo1 UTSW 8 122495750 missense possibly damaging 0.90
R1899:Piezo1 UTSW 8 122482645 unclassified probably benign
R1899:Piezo1 UTSW 8 122489566 missense probably damaging 1.00
R1900:Piezo1 UTSW 8 122482645 unclassified probably benign
R2018:Piezo1 UTSW 8 122482712 missense probably benign 0.43
R2019:Piezo1 UTSW 8 122482712 missense probably benign 0.43
R2219:Piezo1 UTSW 8 122491488 missense probably benign 0.01
R2331:Piezo1 UTSW 8 122487266 unclassified probably null
R3016:Piezo1 UTSW 8 122506027 critical splice donor site probably null
R3699:Piezo1 UTSW 8 122494903 missense probably damaging 1.00
R3700:Piezo1 UTSW 8 122494903 missense probably damaging 1.00
R3746:Piezo1 UTSW 8 122492638 missense probably damaging 1.00
R3905:Piezo1 UTSW 8 122482143 missense probably damaging 1.00
R4093:Piezo1 UTSW 8 122501160 critical splice donor site probably null
R4296:Piezo1 UTSW 8 122491127 missense probably damaging 1.00
R4396:Piezo1 UTSW 8 122498674 missense probably damaging 0.98
R4467:Piezo1 UTSW 8 122486396 missense probably benign 0.17
R4614:Piezo1 UTSW 8 122486411 missense probably benign 0.25
R4642:Piezo1 UTSW 8 122495454 missense probably damaging 1.00
R4688:Piezo1 UTSW 8 122488539 missense probably damaging 1.00
R4734:Piezo1 UTSW 8 122498206 missense probably damaging 1.00
R4749:Piezo1 UTSW 8 122486939 missense possibly damaging 0.48
R4749:Piezo1 UTSW 8 122498206 missense probably damaging 1.00
R4865:Piezo1 UTSW 8 122486921 missense probably damaging 1.00
R4962:Piezo1 UTSW 8 122486481 missense probably benign 0.41
R5026:Piezo1 UTSW 8 122486818 missense probably benign 0.11
R5418:Piezo1 UTSW 8 122486780 missense probably damaging 1.00
R5625:Piezo1 UTSW 8 122482960 missense probably benign 0.01
R5759:Piezo1 UTSW 8 122507655 missense probably damaging 0.98
R5864:Piezo1 UTSW 8 122486373 missense possibly damaging 0.75
R5898:Piezo1 UTSW 8 122487943 missense probably benign 0.00
R5948:Piezo1 UTSW 8 122483347 missense probably benign 0.01
R6052:Piezo1 UTSW 8 122506269 missense probably damaging 1.00
R6086:Piezo1 UTSW 8 122501657 missense possibly damaging 0.73
R6216:Piezo1 UTSW 8 122489130 missense probably benign 0.05
R6271:Piezo1 UTSW 8 122494932 missense probably damaging 1.00
R6549:Piezo1 UTSW 8 122500263 missense probably benign 0.02
R6723:Piezo1 UTSW 8 122507627 missense probably benign 0.15
R6871:Piezo1 UTSW 8 122485027 unclassified probably null
R6919:Piezo1 UTSW 8 122490281 missense probably damaging 1.00
R7085:Piezo1 UTSW 8 122490894 missense
R7105:Piezo1 UTSW 8 122482118 missense unknown
R7267:Piezo1 UTSW 8 122497529 missense
Predicted Primers PCR Primer
(F):5'- AGACAGACTCTGATCCCAGG -3'
(R):5'- CCATTGGGGTACAGTACTGATC -3'

Sequencing Primer
(F):5'- TCCTGCTCAGGAGAATTC -3'
(R):5'- TGTCTTCCCGGCACCAG -3'
Posted On2016-03-17