Incidental Mutation 'R4869:Gabrg2'
ID376431
Institutional Source Beutler Lab
Gene Symbol Gabrg2
Ensembl Gene ENSMUSG00000020436
Gene Namegamma-aminobutyric acid (GABA) A receptor, subunit gamma 2
Synonymsgamma2, Gabrg-2, GABAA-R
MMRRC Submission 042479-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R4869 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location41910203-42000857 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 41920404 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 305 (S305T)
Ref Sequence ENSEMBL: ENSMUSP00000104913 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070725] [ENSMUST00000070735] [ENSMUST00000109290]
Predicted Effect possibly damaging
Transcript: ENSMUST00000070725
AA Change: S305T

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000064739
Gene: ENSMUSG00000020436
AA Change: S305T

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
Pfam:Neur_chan_LBD 65 271 2.7e-55 PFAM
Pfam:Neur_chan_memb 278 408 1.8e-46 PFAM
transmembrane domain 442 464 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000070735
AA Change: S305T

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000063812
Gene: ENSMUSG00000020436
AA Change: S305T

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
Pfam:Neur_chan_LBD 65 271 2.9e-53 PFAM
Pfam:Neur_chan_memb 278 419 2.2e-38 PFAM
transmembrane domain 450 472 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109290
AA Change: S305T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104913
Gene: ENSMUSG00000020436
AA Change: S305T

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
Pfam:Neur_chan_LBD 65 271 1.2e-55 PFAM
Pfam:Neur_chan_memb 278 381 4.3e-44 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125365
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146198
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155032
Meta Mutation Damage Score 0.12 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 99% (102/103)
MGI Phenotype FUNCTION: This gene encodes a gamma-aminobutyric acid (GABA)-A receptor subunit, which is a member of the ligand-gated ion channel family. GABA is the major inhibitory neurotransmitter in the adult central nervous system, and conversely exhibits an excitatory function during development. GABA-A receptors are pentameric, consisting of proteins from several subunit classes: alpha, beta, gamma, delta and rho. This gene encodes one of three gamma subunits in mammals, which contain the binding site for benzodiazepine drugs. Several mutations in this gene are associated with epileptic seizures, and genetic knockdown is associated with anxiety behavior. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit retarded postnatal growth, impaired sensorimotor function, and greatly reduced lifespan. Heterozygotes show enhanced anxiety-related behaviors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik C A 9: 57,254,205 K943N probably damaging Het
Abca13 G A 11: 9,315,434 probably null Het
Ankub1 A G 3: 57,690,330 L73P probably damaging Het
Birc6 A G 17: 74,586,012 I982V probably benign Het
Cabyr G T 18: 12,751,818 *454L probably null Het
Ccdc57 C T 11: 120,903,518 probably null Het
Cd209c A G 8: 3,944,077 F128L probably benign Het
Cdh23 A T 10: 60,376,934 I1566N probably damaging Het
Cdon T C 9: 35,452,904 V106A possibly damaging Het
Cebpa G T 7: 35,119,821 G135C probably damaging Het
Cfap65 A G 1: 74,919,261 S896P probably benign Het
Ciz1 T C 2: 32,364,235 S63P probably damaging Het
Clybl G A 14: 122,384,206 V269M probably damaging Het
Ctnnb1 G T 9: 120,952,994 V358L possibly damaging Het
Cwh43 G T 5: 73,428,673 probably null Het
Cyp2d10 G A 15: 82,403,766 R379C probably benign Het
Dab2ip C A 2: 35,720,037 R727S probably damaging Het
Dmrt1 T A 19: 25,505,855 M1K probably null Het
Dock1 A T 7: 134,734,071 I65F probably damaging Het
Ercc2 T C 7: 19,386,807 V155A probably damaging Het
Exph5 A C 9: 53,376,239 D1540A possibly damaging Het
Fat3 T A 9: 16,377,477 H250L probably damaging Het
Fbxw10 C A 11: 62,862,731 A517E probably damaging Het
Furin A T 7: 80,396,979 N176K probably damaging Het
Gabrb3 A G 7: 57,792,459 probably benign Het
Gas6 G T 8: 13,475,086 S299R possibly damaging Het
Gga3 G T 11: 115,586,285 probably benign Het
Gle1 A G 2: 29,936,020 E37G possibly damaging Het
Gm6614 T C 6: 141,987,766 D431G probably damaging Het
Gm7964 A G 7: 83,756,142 D80G possibly damaging Het
Gne C T 4: 44,055,204 probably null Het
Grid2 G T 6: 64,429,740 G695W probably damaging Het
H2-M10.6 A T 17: 36,812,533 M40L probably benign Het
Hectd4 G T 5: 121,322,672 V905L possibly damaging Het
Isyna1 C A 8: 70,596,762 S441R possibly damaging Het
Kcnh3 C T 15: 99,242,032 S933L probably benign Het
Knl1 T C 2: 119,072,351 I1511T possibly damaging Het
Krt73 T C 15: 101,796,398 E351G probably damaging Het
Lipo4 C T 19: 33,501,553 probably null Het
Llgl1 T A 11: 60,707,210 L360* probably null Het
Map2k5 G A 9: 63,322,243 R169* probably null Het
Muc19 A T 15: 91,897,716 noncoding transcript Het
Muc4 G A 16: 32,754,836 probably benign Het
Myh4 A G 11: 67,252,664 E1074G probably damaging Het
Naip5 C T 13: 100,245,131 G210E probably damaging Het
Nalcn A G 14: 123,599,884 S23P probably benign Het
Nepro T A 16: 44,730,173 M176K probably damaging Het
Nlrp6 G A 7: 140,924,093 C704Y probably damaging Het
Notch1 A G 2: 26,471,179 S1100P probably benign Het
Nrxn3 A G 12: 88,795,582 E133G possibly damaging Het
Parp9 T C 16: 35,956,904 L406S probably damaging Het
Peak1 G T 9: 56,227,592 A155D probably benign Het
Piezo1 G A 8: 122,487,545 H1628Y probably benign Het
Piwil2 A G 14: 70,395,362 V587A probably benign Het
Pkn2 A G 3: 142,803,618 Y722H probably damaging Het
Plch2 A T 4: 154,989,428 I834K probably benign Het
Pld1 A G 3: 28,109,802 T795A possibly damaging Het
Plekhh1 A G 12: 79,050,386 S103G probably benign Het
Ppl T C 16: 5,104,889 Y246C probably damaging Het
Prpf40b G A 15: 99,309,845 probably benign Het
Prr14l A G 5: 32,828,833 L1106P probably damaging Het
Ptbp3 T A 4: 59,524,443 I28F possibly damaging Het
Ptrh2 A T 11: 86,689,805 K83* probably null Het
Rai1 T C 11: 60,186,762 S551P probably damaging Het
Rapgefl1 A T 11: 98,851,109 Q633L probably damaging Het
Rb1cc1 T C 1: 6,215,021 probably benign Het
Rif1 T A 2: 52,093,611 probably benign Het
Rnf141 A G 7: 110,825,350 Y101H probably damaging Het
Rnf219 A G 14: 104,478,816 I707T probably damaging Het
Rttn T A 18: 89,043,014 L1102* probably null Het
Sall4 G A 2: 168,755,717 S401F probably damaging Het
Sec11c T C 18: 65,801,470 I36T probably benign Het
Sel1l A G 12: 91,814,054 probably benign Het
Setd1a T C 7: 127,797,604 probably benign Het
Sez6l2 C T 7: 126,961,842 P433L probably benign Het
Sgf29 T C 7: 126,649,375 probably benign Het
Slc47a1 A G 11: 61,362,694 V305A probably benign Het
Sun2 T C 15: 79,728,386 probably benign Het
Tecta T C 9: 42,375,534 S609G probably benign Het
Tex45 G A 8: 3,487,148 S498N probably damaging Het
Tmprss6 T A 15: 78,443,680 probably null Het
Tns1 T C 1: 73,952,615 H968R probably benign Het
Tomm34 G A 2: 164,054,717 A270V probably damaging Het
Tpo T C 12: 30,103,365 K330R probably benign Het
Ttn T A 2: 76,712,493 Y33383F probably damaging Het
Unc13c G T 9: 73,680,434 A1439D probably benign Het
Vcp C T 4: 42,993,691 R147H probably benign Het
Vps13d A G 4: 145,128,042 L2272P probably damaging Het
Wdfy3 A G 5: 101,894,921 L1988P probably damaging Het
Wwc2 A G 8: 47,920,678 F51S probably damaging Het
Zfp454 C T 11: 50,873,153 C373Y probably damaging Het
Zfp853 A T 5: 143,288,293 V473E probably damaging Het
Zfp959 A T 17: 55,897,228 R85S possibly damaging Het
Other mutations in Gabrg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00640:Gabrg2 APN 11 41971772 missense possibly damaging 0.87
IGL00787:Gabrg2 APN 11 41912522 missense probably benign 0.00
IGL01941:Gabrg2 APN 11 41971721 missense probably damaging 1.00
IGL02801:Gabrg2 APN 11 41912393 missense probably damaging 1.00
R0376:Gabrg2 UTSW 11 41916315 missense possibly damaging 0.92
R1607:Gabrg2 UTSW 11 41976663 missense probably damaging 0.98
R1934:Gabrg2 UTSW 11 41920470 missense probably benign 0.10
R2226:Gabrg2 UTSW 11 41971908 missense probably damaging 1.00
R2281:Gabrg2 UTSW 11 41976636 missense possibly damaging 0.72
R4013:Gabrg2 UTSW 11 41971880 missense possibly damaging 0.83
R4675:Gabrg2 UTSW 11 41968823 missense probably damaging 1.00
R5282:Gabrg2 UTSW 11 41971732 missense probably damaging 1.00
R5316:Gabrg2 UTSW 11 41976558 missense probably damaging 1.00
R5729:Gabrg2 UTSW 11 41967623 missense probably damaging 1.00
R5876:Gabrg2 UTSW 11 41968820 missense probably damaging 1.00
R6279:Gabrg2 UTSW 11 42000523 unclassified probably null
R6300:Gabrg2 UTSW 11 42000523 unclassified probably null
R6315:Gabrg2 UTSW 11 41971861 missense probably damaging 0.99
R7181:Gabrg2 UTSW 11 41920434 missense probably damaging 1.00
R7182:Gabrg2 UTSW 11 41920506 missense probably damaging 0.98
X0065:Gabrg2 UTSW 11 41912369 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGTAAGCTCTCATGAATATGC -3'
(R):5'- CTGTGTCCATAGCTCAGTCC -3'

Sequencing Primer
(F):5'- GGTAAGCTCTCATGAATATGCATGTG -3'
(R):5'- AGTCCTTCTCTTTCAGGTGACTATG -3'
Posted On2016-03-17