Incidental Mutation 'R4869:Rai1'
ID376433
Institutional Source Beutler Lab
Gene Symbol Rai1
Ensembl Gene ENSMUSG00000062115
Gene Nameretinoic acid induced 1
SynonymsGt1
MMRRC Submission 042479-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4869 (G1)
Quality Score200
Status Validated
Chromosome11
Chromosomal Location60105013-60199197 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 60186762 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 551 (S551P)
Ref Sequence ENSEMBL: ENSMUSP00000126183 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064190] [ENSMUST00000090806] [ENSMUST00000102688] [ENSMUST00000132012] [ENSMUST00000171108]
Predicted Effect probably damaging
Transcript: ENSMUST00000064190
AA Change: S551P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070896
Gene: ENSMUSG00000062115
AA Change: S551P

DomainStartEndE-ValueType
low complexity region 55 69 N/A INTRINSIC
low complexity region 115 129 N/A INTRINSIC
low complexity region 168 175 N/A INTRINSIC
low complexity region 294 304 N/A INTRINSIC
low complexity region 322 336 N/A INTRINSIC
low complexity region 409 424 N/A INTRINSIC
low complexity region 699 708 N/A INTRINSIC
low complexity region 836 842 N/A INTRINSIC
low complexity region 1015 1030 N/A INTRINSIC
low complexity region 1049 1064 N/A INTRINSIC
low complexity region 1084 1102 N/A INTRINSIC
low complexity region 1262 1272 N/A INTRINSIC
low complexity region 1375 1388 N/A INTRINSIC
low complexity region 1455 1465 N/A INTRINSIC
low complexity region 1499 1515 N/A INTRINSIC
low complexity region 1597 1609 N/A INTRINSIC
low complexity region 1680 1690 N/A INTRINSIC
low complexity region 1714 1732 N/A INTRINSIC
PHD 1838 1885 3.59e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000090806
AA Change: S551P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088315
Gene: ENSMUSG00000062115
AA Change: S551P

DomainStartEndE-ValueType
low complexity region 55 69 N/A INTRINSIC
low complexity region 115 129 N/A INTRINSIC
low complexity region 168 175 N/A INTRINSIC
low complexity region 294 304 N/A INTRINSIC
low complexity region 322 336 N/A INTRINSIC
low complexity region 409 424 N/A INTRINSIC
low complexity region 699 708 N/A INTRINSIC
low complexity region 836 842 N/A INTRINSIC
low complexity region 1015 1030 N/A INTRINSIC
low complexity region 1049 1064 N/A INTRINSIC
low complexity region 1084 1102 N/A INTRINSIC
low complexity region 1262 1272 N/A INTRINSIC
low complexity region 1375 1388 N/A INTRINSIC
low complexity region 1455 1465 N/A INTRINSIC
low complexity region 1499 1515 N/A INTRINSIC
low complexity region 1597 1609 N/A INTRINSIC
low complexity region 1680 1690 N/A INTRINSIC
low complexity region 1714 1732 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102688
AA Change: S551P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099749
Gene: ENSMUSG00000062115
AA Change: S551P

DomainStartEndE-ValueType
low complexity region 55 69 N/A INTRINSIC
low complexity region 115 129 N/A INTRINSIC
low complexity region 168 175 N/A INTRINSIC
low complexity region 294 304 N/A INTRINSIC
low complexity region 322 336 N/A INTRINSIC
low complexity region 409 424 N/A INTRINSIC
low complexity region 699 708 N/A INTRINSIC
low complexity region 836 842 N/A INTRINSIC
low complexity region 1015 1030 N/A INTRINSIC
low complexity region 1049 1064 N/A INTRINSIC
low complexity region 1084 1102 N/A INTRINSIC
low complexity region 1262 1272 N/A INTRINSIC
low complexity region 1375 1388 N/A INTRINSIC
low complexity region 1455 1465 N/A INTRINSIC
low complexity region 1499 1515 N/A INTRINSIC
low complexity region 1597 1609 N/A INTRINSIC
low complexity region 1680 1690 N/A INTRINSIC
low complexity region 1714 1732 N/A INTRINSIC
PHD 1838 1885 3.59e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132012
SMART Domains Protein: ENSMUSP00000118543
Gene: ENSMUSG00000062115

DomainStartEndE-ValueType
low complexity region 55 69 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149770
Predicted Effect probably damaging
Transcript: ENSMUST00000171108
AA Change: S551P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126183
Gene: ENSMUSG00000062115
AA Change: S551P

DomainStartEndE-ValueType
low complexity region 55 69 N/A INTRINSIC
low complexity region 115 129 N/A INTRINSIC
low complexity region 168 175 N/A INTRINSIC
low complexity region 294 304 N/A INTRINSIC
low complexity region 322 336 N/A INTRINSIC
low complexity region 409 424 N/A INTRINSIC
low complexity region 699 708 N/A INTRINSIC
low complexity region 836 842 N/A INTRINSIC
low complexity region 1015 1030 N/A INTRINSIC
low complexity region 1049 1064 N/A INTRINSIC
low complexity region 1084 1102 N/A INTRINSIC
low complexity region 1262 1272 N/A INTRINSIC
low complexity region 1375 1388 N/A INTRINSIC
low complexity region 1455 1465 N/A INTRINSIC
low complexity region 1499 1515 N/A INTRINSIC
low complexity region 1597 1609 N/A INTRINSIC
low complexity region 1680 1690 N/A INTRINSIC
low complexity region 1714 1732 N/A INTRINSIC
PHD 1838 1885 3.59e-6 SMART
Meta Mutation Damage Score 0.27 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 99% (102/103)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is located within the Smith-Magenis syndrome region on chromosome 17. It is highly similar to its mouse counterpart and is expressed at high levels mainly in neuronal tissues. The protein encoded by this gene includes a polymorphic polyglutamine tract in the N-terminal domain. Expression of the mouse counterpart in neurons is induced by retinoic acid. This gene is associated with both the severity of the phenotype and the response to medication in schizophrenic patients. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions of this gene usually die as embryos. Survivors have shortened life spans and show severe craniofacial and axial skeleton defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik C A 9: 57,254,205 K943N probably damaging Het
Abca13 G A 11: 9,315,434 probably null Het
Ankub1 A G 3: 57,690,330 L73P probably damaging Het
Birc6 A G 17: 74,586,012 I982V probably benign Het
Cabyr G T 18: 12,751,818 *454L probably null Het
Ccdc57 C T 11: 120,903,518 probably null Het
Cd209c A G 8: 3,944,077 F128L probably benign Het
Cdh23 A T 10: 60,376,934 I1566N probably damaging Het
Cdon T C 9: 35,452,904 V106A possibly damaging Het
Cebpa G T 7: 35,119,821 G135C probably damaging Het
Cfap65 A G 1: 74,919,261 S896P probably benign Het
Ciz1 T C 2: 32,364,235 S63P probably damaging Het
Clybl G A 14: 122,384,206 V269M probably damaging Het
Ctnnb1 G T 9: 120,952,994 V358L possibly damaging Het
Cwh43 G T 5: 73,428,673 probably null Het
Cyp2d10 G A 15: 82,403,766 R379C probably benign Het
Dab2ip C A 2: 35,720,037 R727S probably damaging Het
Dmrt1 T A 19: 25,505,855 M1K probably null Het
Dock1 A T 7: 134,734,071 I65F probably damaging Het
Ercc2 T C 7: 19,386,807 V155A probably damaging Het
Exph5 A C 9: 53,376,239 D1540A possibly damaging Het
Fat3 T A 9: 16,377,477 H250L probably damaging Het
Fbxw10 C A 11: 62,862,731 A517E probably damaging Het
Furin A T 7: 80,396,979 N176K probably damaging Het
Gabrb3 A G 7: 57,792,459 probably benign Het
Gabrg2 A T 11: 41,920,404 S305T probably damaging Het
Gas6 G T 8: 13,475,086 S299R possibly damaging Het
Gga3 G T 11: 115,586,285 probably benign Het
Gle1 A G 2: 29,936,020 E37G possibly damaging Het
Gm6614 T C 6: 141,987,766 D431G probably damaging Het
Gm7964 A G 7: 83,756,142 D80G possibly damaging Het
Gne C T 4: 44,055,204 probably null Het
Grid2 G T 6: 64,429,740 G695W probably damaging Het
H2-M10.6 A T 17: 36,812,533 M40L probably benign Het
Hectd4 G T 5: 121,322,672 V905L possibly damaging Het
Isyna1 C A 8: 70,596,762 S441R possibly damaging Het
Kcnh3 C T 15: 99,242,032 S933L probably benign Het
Knl1 T C 2: 119,072,351 I1511T possibly damaging Het
Krt73 T C 15: 101,796,398 E351G probably damaging Het
Lipo4 C T 19: 33,501,553 probably null Het
Llgl1 T A 11: 60,707,210 L360* probably null Het
Map2k5 G A 9: 63,322,243 R169* probably null Het
Muc19 A T 15: 91,897,716 noncoding transcript Het
Muc4 G A 16: 32,754,836 probably benign Het
Myh4 A G 11: 67,252,664 E1074G probably damaging Het
Naip5 C T 13: 100,245,131 G210E probably damaging Het
Nalcn A G 14: 123,599,884 S23P probably benign Het
Nepro T A 16: 44,730,173 M176K probably damaging Het
Nlrp6 G A 7: 140,924,093 C704Y probably damaging Het
Notch1 A G 2: 26,471,179 S1100P probably benign Het
Nrxn3 A G 12: 88,795,582 E133G possibly damaging Het
Parp9 T C 16: 35,956,904 L406S probably damaging Het
Peak1 G T 9: 56,227,592 A155D probably benign Het
Piezo1 G A 8: 122,487,545 H1628Y probably benign Het
Piwil2 A G 14: 70,395,362 V587A probably benign Het
Pkn2 A G 3: 142,803,618 Y722H probably damaging Het
Plch2 A T 4: 154,989,428 I834K probably benign Het
Pld1 A G 3: 28,109,802 T795A possibly damaging Het
Plekhh1 A G 12: 79,050,386 S103G probably benign Het
Ppl T C 16: 5,104,889 Y246C probably damaging Het
Prpf40b G A 15: 99,309,845 probably benign Het
Prr14l A G 5: 32,828,833 L1106P probably damaging Het
Ptbp3 T A 4: 59,524,443 I28F possibly damaging Het
Ptrh2 A T 11: 86,689,805 K83* probably null Het
Rapgefl1 A T 11: 98,851,109 Q633L probably damaging Het
Rb1cc1 T C 1: 6,215,021 probably benign Het
Rif1 T A 2: 52,093,611 probably benign Het
Rnf141 A G 7: 110,825,350 Y101H probably damaging Het
Rnf219 A G 14: 104,478,816 I707T probably damaging Het
Rttn T A 18: 89,043,014 L1102* probably null Het
Sall4 G A 2: 168,755,717 S401F probably damaging Het
Sec11c T C 18: 65,801,470 I36T probably benign Het
Sel1l A G 12: 91,814,054 probably benign Het
Setd1a T C 7: 127,797,604 probably benign Het
Sez6l2 C T 7: 126,961,842 P433L probably benign Het
Sgf29 T C 7: 126,649,375 probably benign Het
Slc47a1 A G 11: 61,362,694 V305A probably benign Het
Sun2 T C 15: 79,728,386 probably benign Het
Tecta T C 9: 42,375,534 S609G probably benign Het
Tex45 G A 8: 3,487,148 S498N probably damaging Het
Tmprss6 T A 15: 78,443,680 probably null Het
Tns1 T C 1: 73,952,615 H968R probably benign Het
Tomm34 G A 2: 164,054,717 A270V probably damaging Het
Tpo T C 12: 30,103,365 K330R probably benign Het
Ttn T A 2: 76,712,493 Y33383F probably damaging Het
Unc13c G T 9: 73,680,434 A1439D probably benign Het
Vcp C T 4: 42,993,691 R147H probably benign Het
Vps13d A G 4: 145,128,042 L2272P probably damaging Het
Wdfy3 A G 5: 101,894,921 L1988P probably damaging Het
Wwc2 A G 8: 47,920,678 F51S probably damaging Het
Zfp454 C T 11: 50,873,153 C373Y probably damaging Het
Zfp853 A T 5: 143,288,293 V473E probably damaging Het
Zfp959 A T 17: 55,897,228 R85S possibly damaging Het
Other mutations in Rai1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Rai1 APN 11 60185391 missense probably damaging 1.00
IGL00952:Rai1 APN 11 60187992 nonsense probably null
IGL01118:Rai1 APN 11 60187438 missense probably damaging 0.98
IGL02540:Rai1 APN 11 60186924 missense probably benign 0.09
IGL02624:Rai1 APN 11 60188743 missense probably damaging 1.00
IGL02696:Rai1 APN 11 60193956 missense probably benign
IGL02940:Rai1 APN 11 60187018 missense probably benign 0.03
IGL02970:Rai1 APN 11 60185733 missense probably damaging 1.00
IGL03006:Rai1 APN 11 60188205 missense possibly damaging 0.95
R0557:Rai1 UTSW 11 60190495 missense probably benign 0.00
R1438:Rai1 UTSW 11 60185395 missense probably benign 0.00
R1712:Rai1 UTSW 11 60187602 missense probably benign
R1837:Rai1 UTSW 11 60189398 missense probably damaging 1.00
R1899:Rai1 UTSW 11 60185920 missense probably benign 0.16
R2024:Rai1 UTSW 11 60185589 missense probably damaging 0.99
R2141:Rai1 UTSW 11 60189467 missense possibly damaging 0.94
R2168:Rai1 UTSW 11 60187596 missense probably benign 0.01
R2404:Rai1 UTSW 11 60189924 missense probably benign
R4894:Rai1 UTSW 11 60186746 missense probably damaging 1.00
R5082:Rai1 UTSW 11 60185919 missense possibly damaging 0.48
R5093:Rai1 UTSW 11 60188656 missense probably benign 0.00
R5221:Rai1 UTSW 11 60190597 missense probably damaging 1.00
R5503:Rai1 UTSW 11 60186453 missense probably benign 0.00
R5587:Rai1 UTSW 11 60189859 missense probably damaging 1.00
R5849:Rai1 UTSW 11 60190521 missense possibly damaging 0.90
R5914:Rai1 UTSW 11 60187804 missense probably benign
R5950:Rai1 UTSW 11 60187593 missense probably damaging 1.00
R6111:Rai1 UTSW 11 60187906 missense probably damaging 0.99
R6450:Rai1 UTSW 11 60186603 missense probably benign 0.30
R6785:Rai1 UTSW 11 60188794 missense probably benign
R6889:Rai1 UTSW 11 60185715 missense probably damaging 1.00
X0018:Rai1 UTSW 11 60186436 missense probably benign 0.03
X0019:Rai1 UTSW 11 60189940 missense probably benign 0.14
X0024:Rai1 UTSW 11 60187395 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- AAGAACCTCGTGTCCAGGAC -3'
(R):5'- TCAGCCTTCTCAACAATGGC -3'

Sequencing Primer
(F):5'- AGCACTGTAGCCCTGAAGG -3'
(R):5'- TCAACAATGGCTTCCTGCAG -3'
Posted On2016-03-17