Incidental Mutation 'R4869:Ppl'
ID376458
Institutional Source Beutler Lab
Gene Symbol Ppl
Ensembl Gene ENSMUSG00000039457
Gene Nameperiplakin
Synonyms
MMRRC Submission 042479-MU
Accession Numbers

Genbank: NM_008909

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4869 (G1)
Quality Score218
Status Validated
Chromosome16
Chromosomal Location5086291-5132421 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 5104889 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 246 (Y246C)
Ref Sequence ENSEMBL: ENSMUSP00000039360 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035672]
Predicted Effect probably damaging
Transcript: ENSMUST00000035672
AA Change: Y246C

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000039360
Gene: ENSMUSG00000039457
AA Change: Y246C

DomainStartEndE-ValueType
SPEC 123 211 1.58e0 SMART
SPEC 214 315 3.38e-2 SMART
SPEC 321 483 1.11e-2 SMART
SPEC 503 610 4.96e0 SMART
Blast:SPEC 613 717 5e-59 BLAST
low complexity region 718 729 N/A INTRINSIC
Blast:SPEC 732 859 2e-60 BLAST
low complexity region 893 908 N/A INTRINSIC
low complexity region 963 982 N/A INTRINSIC
internal_repeat_2 984 1004 3.46e-5 PROSPERO
internal_repeat_1 992 1008 8.09e-7 PROSPERO
low complexity region 1011 1020 N/A INTRINSIC
low complexity region 1027 1042 N/A INTRINSIC
internal_repeat_1 1112 1128 8.09e-7 PROSPERO
coiled coil region 1180 1279 N/A INTRINSIC
low complexity region 1346 1355 N/A INTRINSIC
low complexity region 1386 1433 N/A INTRINSIC
low complexity region 1455 1479 N/A INTRINSIC
Blast:SPEC 1529 1610 8e-30 BLAST
low complexity region 1612 1630 N/A INTRINSIC
PLEC 1649 1683 1.34e-5 SMART
PLEC 1698 1733 2.23e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230554
Meta Mutation Damage Score 0.172 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 99% (102/103)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of desmosomes and of the epidermal cornified envelope in keratinocytes. The N-terminal domain of this protein interacts with the plasma membrane and its C-terminus interacts with intermediate filaments. Through its rod domain, this protein forms complexes with envoplakin. This protein may serve as a link between the cornified envelope and desmosomes as well as intermediate filaments. AKT1/PKB, a protein kinase mediating a variety of cell growth and survival signaling processes, is reported to interact with this protein, suggesting a possible role for this protein as a localization signal in AKT1-mediated signaling. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are fertile and grossly normal with no apparent skin abnormalities. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik C A 9: 57,254,205 K943N probably damaging Het
Abca13 G A 11: 9,315,434 probably null Het
Ankub1 A G 3: 57,690,330 L73P probably damaging Het
Birc6 A G 17: 74,586,012 I982V probably benign Het
Cabyr G T 18: 12,751,818 *454L probably null Het
Ccdc57 C T 11: 120,903,518 probably null Het
Cd209c A G 8: 3,944,077 F128L probably benign Het
Cdh23 A T 10: 60,376,934 I1566N probably damaging Het
Cdon T C 9: 35,452,904 V106A possibly damaging Het
Cebpa G T 7: 35,119,821 G135C probably damaging Het
Cfap65 A G 1: 74,919,261 S896P probably benign Het
Ciz1 T C 2: 32,364,235 S63P probably damaging Het
Clybl G A 14: 122,384,206 V269M probably damaging Het
Ctnnb1 G T 9: 120,952,994 V358L possibly damaging Het
Cwh43 G T 5: 73,428,673 probably null Het
Cyp2d10 G A 15: 82,403,766 R379C probably benign Het
Dab2ip C A 2: 35,720,037 R727S probably damaging Het
Dmrt1 T A 19: 25,505,855 M1K probably null Het
Dock1 A T 7: 134,734,071 I65F probably damaging Het
Ercc2 T C 7: 19,386,807 V155A probably damaging Het
Exph5 A C 9: 53,376,239 D1540A possibly damaging Het
Fat3 T A 9: 16,377,477 H250L probably damaging Het
Fbxw10 C A 11: 62,862,731 A517E probably damaging Het
Furin A T 7: 80,396,979 N176K probably damaging Het
Gabrb3 A G 7: 57,792,459 probably benign Het
Gabrg2 A T 11: 41,920,404 S305T probably damaging Het
Gas6 G T 8: 13,475,086 S299R possibly damaging Het
Gga3 G T 11: 115,586,285 probably benign Het
Gle1 A G 2: 29,936,020 E37G possibly damaging Het
Gm6614 T C 6: 141,987,766 D431G probably damaging Het
Gm7964 A G 7: 83,756,142 D80G possibly damaging Het
Gne C T 4: 44,055,204 probably null Het
Grid2 G T 6: 64,429,740 G695W probably damaging Het
H2-M10.6 A T 17: 36,812,533 M40L probably benign Het
Hectd4 G T 5: 121,322,672 V905L possibly damaging Het
Isyna1 C A 8: 70,596,762 S441R possibly damaging Het
Kcnh3 C T 15: 99,242,032 S933L probably benign Het
Knl1 T C 2: 119,072,351 I1511T possibly damaging Het
Krt73 T C 15: 101,796,398 E351G probably damaging Het
Lipo4 C T 19: 33,501,553 probably null Het
Llgl1 T A 11: 60,707,210 L360* probably null Het
Map2k5 G A 9: 63,322,243 R169* probably null Het
Muc19 A T 15: 91,897,716 noncoding transcript Het
Muc4 G A 16: 32,754,836 probably benign Het
Myh4 A G 11: 67,252,664 E1074G probably damaging Het
Naip5 C T 13: 100,245,131 G210E probably damaging Het
Nalcn A G 14: 123,599,884 S23P probably benign Het
Nepro T A 16: 44,730,173 M176K probably damaging Het
Nlrp6 G A 7: 140,924,093 C704Y probably damaging Het
Notch1 A G 2: 26,471,179 S1100P probably benign Het
Nrxn3 A G 12: 88,795,582 E133G possibly damaging Het
Parp9 T C 16: 35,956,904 L406S probably damaging Het
Peak1 G T 9: 56,227,592 A155D probably benign Het
Piezo1 G A 8: 122,487,545 H1628Y probably benign Het
Piwil2 A G 14: 70,395,362 V587A probably benign Het
Pkn2 A G 3: 142,803,618 Y722H probably damaging Het
Plch2 A T 4: 154,989,428 I834K probably benign Het
Pld1 A G 3: 28,109,802 T795A possibly damaging Het
Plekhh1 A G 12: 79,050,386 S103G probably benign Het
Prpf40b G A 15: 99,309,845 probably benign Het
Prr14l A G 5: 32,828,833 L1106P probably damaging Het
Ptbp3 T A 4: 59,524,443 I28F possibly damaging Het
Ptrh2 A T 11: 86,689,805 K83* probably null Het
Rai1 T C 11: 60,186,762 S551P probably damaging Het
Rapgefl1 A T 11: 98,851,109 Q633L probably damaging Het
Rb1cc1 T C 1: 6,215,021 probably benign Het
Rif1 T A 2: 52,093,611 probably benign Het
Rnf141 A G 7: 110,825,350 Y101H probably damaging Het
Rnf219 A G 14: 104,478,816 I707T probably damaging Het
Rttn T A 18: 89,043,014 L1102* probably null Het
Sall4 G A 2: 168,755,717 S401F probably damaging Het
Sec11c T C 18: 65,801,470 I36T probably benign Het
Sel1l A G 12: 91,814,054 probably benign Het
Setd1a T C 7: 127,797,604 probably benign Het
Sez6l2 C T 7: 126,961,842 P433L probably benign Het
Sgf29 T C 7: 126,649,375 probably benign Het
Slc47a1 A G 11: 61,362,694 V305A probably benign Het
Sun2 T C 15: 79,728,386 probably benign Het
Tecta T C 9: 42,375,534 S609G probably benign Het
Tex45 G A 8: 3,487,148 S498N probably damaging Het
Tmprss6 T A 15: 78,443,680 probably null Het
Tns1 T C 1: 73,952,615 H968R probably benign Het
Tomm34 G A 2: 164,054,717 A270V probably damaging Het
Tpo T C 12: 30,103,365 K330R probably benign Het
Ttn T A 2: 76,712,493 Y33383F probably damaging Het
Unc13c G T 9: 73,680,434 A1439D probably benign Het
Vcp C T 4: 42,993,691 R147H probably benign Het
Vps13d A G 4: 145,128,042 L2272P probably damaging Het
Wdfy3 A G 5: 101,894,921 L1988P probably damaging Het
Wwc2 A G 8: 47,920,678 F51S probably damaging Het
Zfp454 C T 11: 50,873,153 C373Y probably damaging Het
Zfp853 A T 5: 143,288,293 V473E probably damaging Het
Zfp959 A T 17: 55,897,228 R85S possibly damaging Het
Other mutations in Ppl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Ppl APN 16 5089545 missense probably benign 0.41
IGL00484:Ppl APN 16 5087952 missense probably benign 0.13
IGL00654:Ppl APN 16 5087308 missense possibly damaging 0.94
IGL00832:Ppl APN 16 5088975 missense probably damaging 1.00
IGL01104:Ppl APN 16 5094491 missense probably benign 0.01
IGL01327:Ppl APN 16 5087644 missense probably benign 0.19
IGL01644:Ppl APN 16 5091855 missense probably damaging 1.00
IGL01824:Ppl APN 16 5087889 missense probably damaging 1.00
IGL02071:Ppl APN 16 5113072 missense probably benign 0.04
IGL02085:Ppl APN 16 5089816 missense probably benign 0.09
IGL02282:Ppl APN 16 5101458 missense probably damaging 1.00
IGL02635:Ppl APN 16 5089767 missense probably benign 0.01
IGL02649:Ppl APN 16 5087463 missense probably damaging 1.00
IGL02888:Ppl APN 16 5100407 missense possibly damaging 0.89
IGL03305:Ppl APN 16 5093233 missense possibly damaging 0.62
G4846:Ppl UTSW 16 5087206 missense probably damaging 1.00
IGL03097:Ppl UTSW 16 5096726 missense probably damaging 0.98
R0759:Ppl UTSW 16 5089777 missense probably benign 0.00
R0786:Ppl UTSW 16 5089054 missense probably damaging 1.00
R1024:Ppl UTSW 16 5100000 missense probably damaging 1.00
R1498:Ppl UTSW 16 5104765 missense probably benign 0.05
R1544:Ppl UTSW 16 5102597 nonsense probably null
R1597:Ppl UTSW 16 5107574 missense probably benign 0.20
R1863:Ppl UTSW 16 5087980 missense possibly damaging 0.69
R1921:Ppl UTSW 16 5106124 missense possibly damaging 0.80
R2230:Ppl UTSW 16 5088981 missense possibly damaging 0.51
R2275:Ppl UTSW 16 5094552 missense probably benign 0.00
R2355:Ppl UTSW 16 5094497 missense probably benign 0.00
R3410:Ppl UTSW 16 5107517 missense possibly damaging 0.81
R3737:Ppl UTSW 16 5106857 missense probably benign
R3797:Ppl UTSW 16 5104550 splice site probably benign
R3968:Ppl UTSW 16 5100332 splice site probably null
R3970:Ppl UTSW 16 5100332 splice site probably null
R4034:Ppl UTSW 16 5106857 missense probably benign
R4583:Ppl UTSW 16 5104536 missense probably benign 0.02
R4639:Ppl UTSW 16 5089446 missense probably damaging 1.00
R4762:Ppl UTSW 16 5088982 missense probably benign 0.00
R4828:Ppl UTSW 16 5104926 missense probably damaging 1.00
R4925:Ppl UTSW 16 5104982 missense probably damaging 1.00
R4983:Ppl UTSW 16 5088718 missense possibly damaging 0.75
R4984:Ppl UTSW 16 5087641 missense probably benign
R4997:Ppl UTSW 16 5089371 missense probably damaging 1.00
R5072:Ppl UTSW 16 5088878 missense probably benign 0.01
R5073:Ppl UTSW 16 5088878 missense probably benign 0.01
R5074:Ppl UTSW 16 5088878 missense probably benign 0.01
R5286:Ppl UTSW 16 5089123 nonsense probably null
R5398:Ppl UTSW 16 5104922 missense probably benign 0.00
R5448:Ppl UTSW 16 5107566 missense probably benign
R5664:Ppl UTSW 16 5106055 missense probably benign 0.00
R5873:Ppl UTSW 16 5106049 critical splice donor site probably null
R5918:Ppl UTSW 16 5104901 missense probably benign 0.00
R5951:Ppl UTSW 16 5088628 missense probably benign 0.25
R6038:Ppl UTSW 16 5102581 missense possibly damaging 0.94
R6038:Ppl UTSW 16 5102581 missense possibly damaging 0.94
R6088:Ppl UTSW 16 5104988 missense possibly damaging 0.73
R6149:Ppl UTSW 16 5107596 nonsense probably null
R6358:Ppl UTSW 16 5087929 nonsense probably null
R6379:Ppl UTSW 16 5097691 missense probably benign 0.02
R6468:Ppl UTSW 16 5092441 missense probably damaging 1.00
R6514:Ppl UTSW 16 5087317 missense probably damaging 1.00
R6528:Ppl UTSW 16 5087616 missense probably benign 0.00
R6703:Ppl UTSW 16 5089464 missense probably damaging 0.99
R6721:Ppl UTSW 16 5107469 missense probably damaging 0.97
R6811:Ppl UTSW 16 5089144 missense probably damaging 0.99
R6934:Ppl UTSW 16 5094509 missense probably benign 0.00
R7034:Ppl UTSW 16 5087502 missense probably benign 0.29
R7076:Ppl UTSW 16 5100119 missense probably damaging 1.00
R7300:Ppl UTSW 16 5102371 missense possibly damaging 0.87
X0054:Ppl UTSW 16 5104902 missense probably benign 0.00
Z1088:Ppl UTSW 16 5089507 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ACGCACCTCAATGGAGTTCC -3'
(R):5'- GAAGCCAAGCCGATTCTGTC -3'

Sequencing Primer
(F):5'- AGCAGTTGGTCACCTTCAG -3'
(R):5'- GCCAAGCCGATTCTGTCTTCAC -3'
Posted On2016-03-17