Incidental Mutation 'R4870:Dip2b'
ID376527
Institutional Source Beutler Lab
Gene Symbol Dip2b
Ensembl Gene ENSMUSG00000023026
Gene Namedisco interacting protein 2 homolog B
Synonyms
MMRRC Submission 042480-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.462) question?
Stock #R4870 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location100038664-100219473 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 100195784 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000104599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023768] [ENSMUST00000100203] [ENSMUST00000108971]
Predicted Effect probably benign
Transcript: ENSMUST00000023768
SMART Domains Protein: ENSMUSP00000023768
Gene: ENSMUSG00000023026

DomainStartEndE-ValueType
Pfam:AMP-binding 109 584 9.5e-26 PFAM
Pfam:AMP-binding 760 1235 1.2e-52 PFAM
low complexity region 1299 1311 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100203
SMART Domains Protein: ENSMUSP00000097777
Gene: ENSMUSG00000023026

DomainStartEndE-ValueType
DMAP_binding 12 130 1e-42 SMART
low complexity region 152 168 N/A INTRINSIC
low complexity region 181 192 N/A INTRINSIC
Pfam:AMP-binding 341 817 2e-26 PFAM
Pfam:AMP-binding 993 1468 1.8e-64 PFAM
low complexity region 1532 1544 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108971
SMART Domains Protein: ENSMUSP00000104599
Gene: ENSMUSG00000023026

DomainStartEndE-ValueType
Pfam:AMP-binding 108 583 9.5e-26 PFAM
Pfam:AMP-binding 759 1234 1.2e-52 PFAM
low complexity region 1298 1310 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229080
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230619
SMART Domains
(Predicted Sequence)

DomainStartEndE-ValueType
DMAP_binding 12 130 1e-42 SMART
low complexity region 152 168 N/A INTRINSIC
low complexity region 181 192 N/A INTRINSIC
Pfam:AMP-binding 341 817 2e-26 PFAM
Pfam:AMP-binding 993 1468 1.8e-64 PFAM
low complexity region 1532 1544 N/A INTRINSIC
Meta Mutation Damage Score 0.608 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disco-interacting protein homolog 2 protein family. The encoded protein contains a binding site for the transcriptional regulator DNA methyltransferase 1 associated protein 1 as well as AMP-binding sites. The presence of these sites suggests that the encoded protein may participate in DNA methylation. This gene is located near a folate-sensitive fragile site, and CGG-repeat expansion in the promoter of this gene which affects transcription has been detected in individuals containing this fragile site on chromosome 12. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik C A 7: 34,284,887 V104L possibly damaging Het
Abcb11 A T 2: 69,239,196 I1285N probably damaging Het
Abcc8 G A 7: 46,107,259 R1400* probably null Het
Alox8 T C 11: 69,186,568 Y452C probably damaging Het
Ankle2 T A 5: 110,251,478 probably benign Het
Cdc14a A G 3: 116,423,460 I9T probably benign Het
Ceacam18 T C 7: 43,641,904 C257R probably damaging Het
Cilp T C 9: 65,279,698 V1025A probably damaging Het
Clcn7 G T 17: 25,153,565 G106V probably benign Het
Csnk1d A T 11: 120,983,188 probably benign Het
Cyp11b2 A G 15: 74,853,146 S285P probably benign Het
Dmrt1 T A 19: 25,505,855 M1K probably null Het
Dnajc14 T C 10: 128,817,350 V684A probably benign Het
Dnmt3b A G 2: 153,670,364 Q335R probably benign Het
Exoc3l2 T A 7: 19,495,192 C772S unknown Het
F2rl1 A T 13: 95,513,984 F130Y probably damaging Het
Galk2 C G 2: 125,929,637 S194* probably null Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gpbp1l1 A G 4: 116,573,517 T62A probably benign Het
H2-Q10 A T 17: 35,470,460 D53V probably damaging Het
H2-T22 T C 17: 36,039,032 K356R probably benign Het
Insrr G A 3: 87,811,604 V956M probably damaging Het
Ints7 A G 1: 191,596,331 T239A probably damaging Het
Isl1 A G 13: 116,308,270 probably benign Het
Kcng2 A G 18: 80,322,868 C90R probably benign Het
Kif3c C T 12: 3,401,735 P171S probably damaging Het
Knl1 A G 2: 119,081,513 T1704A probably benign Het
Lats1 A G 10: 7,705,785 Y778C probably damaging Het
Limd2 T C 11: 106,159,389 M1V probably null Het
Mcm10 A T 2: 5,004,159 I333N probably damaging Het
Mipep T A 14: 60,802,880 L283* probably null Het
Mixl1 A G 1: 180,694,672 S215P probably benign Het
Mmp21 A G 7: 133,678,677 L188P probably damaging Het
Mob1a T C 6: 83,340,239 S213P probably benign Het
Ndufaf6 T C 4: 11,060,917 T220A probably benign Het
Nr4a3 A T 4: 48,051,651 Y135F possibly damaging Het
Ntn1 CCTTCTTCT CCTTCT 11: 68,213,026 probably benign Het
Obscn A T 11: 59,136,206 L57Q probably damaging Het
Olfr1161 T C 2: 88,025,460 L246P probably damaging Het
Olfr603 T A 7: 103,383,633 D123V probably damaging Het
Pirb T A 7: 3,712,662 M839L probably benign Het
Plcl2 A G 17: 50,607,226 E421G possibly damaging Het
Ppp1r12b T C 1: 134,949,033 N99S probably benign Het
Ptpro A G 6: 137,377,132 K169E probably damaging Het
Rita1 T A 5: 120,611,383 K88N probably damaging Het
Rptn A T 3: 93,396,469 K370* probably null Het
Simc1 A G 13: 54,539,763 D115G possibly damaging Het
Stab1 T A 14: 31,142,043 N136I probably benign Het
Syt4 T A 18: 31,447,356 probably benign Het
Sytl2 A T 7: 90,388,898 N522I probably damaging Het
Tax1bp1 A G 6: 52,729,493 probably benign Het
Tenm2 A T 11: 36,078,569 D847E probably damaging Het
Th G T 7: 142,894,097 D416E probably benign Het
Tmem44 A T 16: 30,540,773 L46Q probably damaging Het
Trp53bp1 A G 2: 121,256,641 L178P probably damaging Het
Trp63 A G 16: 25,866,218 *285W probably null Het
Tsen34 T C 7: 3,694,381 L12P probably benign Het
Tssk4 C T 14: 55,651,815 T262I probably benign Het
Ttc17 A T 2: 94,366,609 N464K probably damaging Het
Ttll2 C T 17: 7,351,599 V310I probably benign Het
Ubn1 A G 16: 5,077,313 E741G probably damaging Het
Urad T A 5: 147,315,454 I63F probably damaging Het
Vcan T C 13: 89,704,739 T701A probably benign Het
Vmn2r58 A G 7: 41,837,215 V752A possibly damaging Het
Vmn2r69 C A 7: 85,411,585 V264L possibly damaging Het
Zfp292 A G 4: 34,808,917 S1381P probably damaging Het
Zfp955a G A 17: 33,241,725 R478* probably null Het
Znfx1 A C 2: 167,055,269 F578L probably benign Het
Other mutations in Dip2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Dip2b APN 15 100174501 missense probably damaging 1.00
IGL01716:Dip2b APN 15 100209636 missense probably benign 0.00
IGL01893:Dip2b APN 15 100171220 unclassified probably benign
IGL01915:Dip2b APN 15 100178511 missense probably damaging 1.00
IGL02125:Dip2b APN 15 100186250 missense possibly damaging 0.60
IGL02200:Dip2b APN 15 100151202 missense possibly damaging 0.93
IGL02506:Dip2b APN 15 100157281 missense probably damaging 1.00
IGL02571:Dip2b APN 15 100157885 missense possibly damaging 0.93
IGL02706:Dip2b APN 15 100215311 missense probably damaging 0.98
IGL02983:Dip2b APN 15 100132022 missense possibly damaging 0.81
IGL03120:Dip2b APN 15 100203127 unclassified probably benign
IGL03181:Dip2b APN 15 100215207 missense probably damaging 0.98
IGL03229:Dip2b APN 15 100207838 unclassified probably benign
IGL03399:Dip2b APN 15 100175327 missense possibly damaging 0.63
PIT4131001:Dip2b UTSW 15 100202352 missense probably damaging 1.00
R0009:Dip2b UTSW 15 100169312 missense probably damaging 1.00
R0058:Dip2b UTSW 15 100215240 missense probably benign 0.03
R0058:Dip2b UTSW 15 100215240 missense probably benign 0.03
R0092:Dip2b UTSW 15 100202265 missense probably damaging 1.00
R0201:Dip2b UTSW 15 100186147 missense probably damaging 0.98
R0359:Dip2b UTSW 15 100211993 missense probably damaging 0.98
R0390:Dip2b UTSW 15 100193913 missense probably damaging 0.99
R0564:Dip2b UTSW 15 100162719 nonsense probably null
R0730:Dip2b UTSW 15 100171651 missense probably damaging 1.00
R1144:Dip2b UTSW 15 100154250 missense probably benign 0.11
R1200:Dip2b UTSW 15 100209745 missense probably benign 0.00
R1506:Dip2b UTSW 15 100183113 missense probably damaging 1.00
R1750:Dip2b UTSW 15 100178466 missense probably benign
R1760:Dip2b UTSW 15 100212029 missense probably damaging 1.00
R1773:Dip2b UTSW 15 100193961 missense probably benign 0.00
R1812:Dip2b UTSW 15 100198938 splice site probably null
R2264:Dip2b UTSW 15 100203216 missense probably benign 0.05
R3105:Dip2b UTSW 15 100142137 nonsense probably null
R4029:Dip2b UTSW 15 100186172 missense probably damaging 1.00
R4030:Dip2b UTSW 15 100186172 missense probably damaging 1.00
R4296:Dip2b UTSW 15 100181336 missense probably benign
R4392:Dip2b UTSW 15 100162036 missense probably damaging 1.00
R4480:Dip2b UTSW 15 100186301 missense probably damaging 0.99
R4564:Dip2b UTSW 15 100157258 nonsense probably null
R4605:Dip2b UTSW 15 100209636 missense probably benign 0.00
R4606:Dip2b UTSW 15 100215329 missense possibly damaging 0.91
R4634:Dip2b UTSW 15 100160491 missense probably damaging 1.00
R4667:Dip2b UTSW 15 100151360 missense probably benign 0.01
R4739:Dip2b UTSW 15 100207777 missense probably damaging 0.98
R4826:Dip2b UTSW 15 100169281 missense probably damaging 0.99
R4877:Dip2b UTSW 15 100160529 missense possibly damaging 0.49
R4932:Dip2b UTSW 15 100171722 missense probably damaging 1.00
R5009:Dip2b UTSW 15 100195784 splice site probably null
R5169:Dip2b UTSW 15 100205113 missense probably damaging 1.00
R5216:Dip2b UTSW 15 100211986 missense probably damaging 1.00
R5218:Dip2b UTSW 15 100154296 missense probably benign 0.00
R5274:Dip2b UTSW 15 100212104 missense possibly damaging 0.54
R5370:Dip2b UTSW 15 100211986 missense probably damaging 1.00
R5420:Dip2b UTSW 15 100205173 intron probably benign
R5447:Dip2b UTSW 15 100211986 missense probably damaging 1.00
R5670:Dip2b UTSW 15 100190104 missense possibly damaging 0.80
R5768:Dip2b UTSW 15 100157945 missense probably benign 0.32
R5908:Dip2b UTSW 15 100151184 missense possibly damaging 0.93
R5957:Dip2b UTSW 15 100209694 missense probably benign 0.03
R5987:Dip2b UTSW 15 100190079 missense probably damaging 1.00
R6260:Dip2b UTSW 15 100162702 missense probably benign 0.05
R6325:Dip2b UTSW 15 100154282 missense probably benign 0.00
R6367:Dip2b UTSW 15 100115914 missense possibly damaging 0.50
R6391:Dip2b UTSW 15 100151276 missense probably damaging 1.00
R6422:Dip2b UTSW 15 100199011 missense probably damaging 0.98
X0064:Dip2b UTSW 15 100115850 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATGGCTGTCATCCTGGTAG -3'
(R):5'- AACCTCTGGCAGTGAATGG -3'

Sequencing Primer
(F):5'- CCTGGTCTACAAAGTGAGTTCCAG -3'
(R):5'- GCAGTGAATGGCAACTGC -3'
Posted OnMar 17, 2016