Incidental Mutation 'R4871:Plekha5'
ID376583
Institutional Source Beutler Lab
Gene Symbol Plekha5
Ensembl Gene ENSMUSG00000030231
Gene Namepleckstrin homology domain containing, family A member 5
SynonymsPEPP2, Tg(AMH-cre)1Flor, Gt(Ayu21)9Imeg, AMH-Cre, 2810431N21Rik, Ayu21-9
MMRRC Submission 042481-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.251) question?
Stock #R4871 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location140424054-140597110 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 140525910 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 20 (Y20C)
Ref Sequence ENSEMBL: ENSMUSP00000145336 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087622] [ENSMUST00000203517] [ENSMUST00000203774] [ENSMUST00000204145] [ENSMUST00000204876]
Predicted Effect probably damaging
Transcript: ENSMUST00000087622
AA Change: Y129C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084904
Gene: ENSMUSG00000030231
AA Change: Y129C

DomainStartEndE-ValueType
WW 12 44 1.51e-3 SMART
WW 58 90 2.17e-4 SMART
PH 171 271 1.85e-17 SMART
Blast:PH 592 715 7e-39 BLAST
coiled coil region 747 781 N/A INTRINSIC
low complexity region 896 916 N/A INTRINSIC
low complexity region 924 938 N/A INTRINSIC
low complexity region 1206 1224 N/A INTRINSIC
low complexity region 1243 1258 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000203517
AA Change: Y129C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000145478
Gene: ENSMUSG00000030231
AA Change: Y129C

DomainStartEndE-ValueType
WW 12 44 9e-6 SMART
WW 58 90 1.3e-6 SMART
PH 171 271 8.6e-20 SMART
Blast:PH 586 697 3e-15 BLAST
coiled coil region 702 736 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000203774
AA Change: Y20C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144832
Gene: ENSMUSG00000030231
AA Change: Y20C

DomainStartEndE-ValueType
PH 62 162 8.6e-20 SMART
Blast:PH 477 511 4e-8 BLAST
low complexity region 512 521 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000203955
AA Change: Y52C
Predicted Effect probably damaging
Transcript: ENSMUST00000204145
AA Change: Y129C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000145457
Gene: ENSMUSG00000030231
AA Change: Y129C

DomainStartEndE-ValueType
WW 12 44 9e-6 SMART
WW 58 90 1.3e-6 SMART
Blast:PH 114 151 6e-14 BLAST
PDB:2DKP|A 163 196 1e-5 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000204876
AA Change: Y20C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145336
Gene: ENSMUSG00000030231
AA Change: Y20C

DomainStartEndE-ValueType
PH 62 162 8.6e-20 SMART
Blast:PH 483 517 3e-8 BLAST
low complexity region 518 527 N/A INTRINSIC
Meta Mutation Damage Score 0.338 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency 93% (99/107)
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcyap1r1 A G 6: 55,480,093 T270A probably null Het
Adgrv1 A T 13: 81,533,122 probably benign Het
Aldh1b1 A T 4: 45,803,383 D307V probably benign Het
Aldh3a2 A T 11: 61,262,239 C220* probably null Het
Ank2 T C 3: 126,959,795 Y279C probably damaging Het
Anks1 T C 17: 27,991,377 Y444H probably benign Het
Asph G T 4: 9,531,968 T383K probably benign Het
Asphd1 G T 7: 126,948,575 S185R possibly damaging Het
Bcl2a1d T A 9: 88,731,695 I9F probably damaging Het
Bcl2l11 T C 2: 128,129,041 probably benign Het
C2cd3 T G 7: 100,413,374 S656A possibly damaging Het
Ccdc109b C T 3: 129,917,036 W249* probably null Het
Cd5l T C 3: 87,367,622 V156A probably damaging Het
Cdh8 G C 8: 99,030,904 N687K probably damaging Het
Cdk19 A G 10: 40,476,236 D338G probably benign Het
Cenpf A G 1: 189,658,531 C1035R probably damaging Het
Cep290 A G 10: 100,548,914 R1845G probably benign Het
Cep295nl G T 11: 118,333,824 Q65K probably damaging Het
Ciz1 T C 2: 32,372,288 probably benign Het
Clasrp T C 7: 19,590,248 D234G possibly damaging Het
Dctd C T 8: 48,137,414 probably benign Het
Ddr2 A G 1: 170,004,771 V150A probably benign Het
Dnah7b T C 1: 46,081,444 S74P probably benign Het
Dnttip2 C A 3: 122,285,101 A743E probably damaging Het
Dysf A T 6: 84,067,023 Q281L possibly damaging Het
Ece2 A G 16: 20,644,155 E610G probably damaging Het
Edem3 T G 1: 151,804,231 probably null Het
Ext1 G T 15: 53,092,377 N441K probably benign Het
Fam118a A G 15: 85,058,768 R333G probably damaging Het
Fam45a A G 19: 60,830,814 E120G probably damaging Het
Fat4 C T 3: 38,891,605 T1549I probably damaging Het
Fbxo4 A G 15: 3,975,912 V162A probably damaging Het
Fgd2 A G 17: 29,373,249 H385R possibly damaging Het
Garnl3 A T 2: 33,087,088 M1K probably null Het
Gm37267 T G 1: 180,510,518 noncoding transcript Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gpbar1 C T 1: 74,279,543 A315V probably damaging Het
Grm2 T C 9: 106,647,645 I624V probably benign Het
Hmcn1 T C 1: 150,593,085 I5042V probably benign Het
Hnf4g T C 3: 3,651,388 Y291H possibly damaging Het
Ighm A G 12: 113,421,621 S240P unknown Het
Igkv4-91 A G 6: 68,768,620 I98T probably damaging Het
Krt72 T C 15: 101,786,034 N142S probably damaging Het
Kynu T A 2: 43,679,818 Y371N possibly damaging Het
Ly9 G T 1: 171,607,330 probably benign Het
Man1a2 C A 3: 100,617,056 V359F probably damaging Het
Mast1 T C 8: 84,920,658 I623M probably damaging Het
Mb A G 15: 77,022,487 probably null Het
Mcm4 A C 16: 15,634,510 L113* probably null Het
Mme T A 3: 63,340,032 V246E probably benign Het
Mrpl38 A G 11: 116,134,272 Y232H probably damaging Het
Myh7b T A 2: 155,613,500 M89K probably benign Het
Notch4 A G 17: 34,577,562 S892G possibly damaging Het
Nt5dc3 A G 10: 86,817,077 Y245C probably damaging Het
Ntn1 CCTTCTTCT CCTTCT 11: 68,213,026 probably benign Het
Olfr101 T A 17: 37,300,204 T73S probably benign Het
Olfr1024 T A 2: 85,904,371 I228F probably benign Het
Olfr104-ps A T 17: 37,362,446 I107L probably benign Het
Olfr1066 A T 2: 86,455,809 I154N possibly damaging Het
Olfr305 A T 7: 86,363,484 N284K probably damaging Het
Olfr883 G T 9: 38,026,526 C240F probably damaging Het
Palld A T 8: 61,549,781 probably benign Het
Pcdhga10 T C 18: 37,748,200 V338A probably damaging Het
Pcdhga11 A G 18: 37,757,406 Y489C probably damaging Het
Pgm1 T C 5: 64,103,894 Y244H probably benign Het
Phactr4 A T 4: 132,378,448 S102R probably damaging Het
Rdh19 A G 10: 127,860,144 D255G probably benign Het
Rgs3 T C 4: 62,631,295 V438A probably benign Het
Rnf186 A G 4: 138,967,943 T265A probably benign Het
Ror1 T C 4: 100,425,998 F420S probably benign Het
Rtkn2 A G 10: 68,005,633 K204E probably damaging Het
Rundc1 A G 11: 101,434,048 T527A probably benign Het
Samd4 T C 14: 47,066,463 S301P probably damaging Het
Scaf1 G A 7: 45,005,879 probably benign Het
Srgap2 A G 1: 131,289,472 V1034A probably benign Het
Stab2 T C 10: 86,942,235 D743G probably damaging Het
Stim1 A T 7: 102,354,572 I71F probably damaging Het
Stk17b T C 1: 53,757,534 D358G probably benign Het
Sun2 A G 15: 79,727,564 Y551H probably damaging Het
Tas2r110 A T 6: 132,868,128 T41S probably benign Het
Tead3 T A 17: 28,333,615 E268V probably damaging Het
Tead3 A G 17: 28,334,988 S131P probably benign Het
Tepsin A T 11: 120,091,525 M505K possibly damaging Het
Trbv29 A G 6: 41,271,734 Y66C possibly damaging Het
Ttc6 A G 12: 57,702,356 Q1358R probably damaging Het
Ttll2 C T 17: 7,351,599 V310I probably benign Het
Uaca T C 9: 60,846,001 V76A probably damaging Het
Vwf A T 6: 125,686,462 T2789S probably benign Het
Yipf4 T C 17: 74,494,094 F136L probably benign Het
Zdhhc1 CGGGGG CGGGGGG 8: 105,483,744 probably null Het
Zfp804b A T 5: 6,876,479 D51E probably damaging Het
Zfyve9 C T 4: 108,680,986 G969R probably damaging Het
Other mutations in Plekha5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Plekha5 APN 6 140570096 splice site probably benign
IGL00908:Plekha5 APN 6 140550930 missense probably damaging 1.00
IGL01346:Plekha5 APN 6 140534566 splice site probably benign
IGL01380:Plekha5 APN 6 140570316 splice site probably benign
IGL01406:Plekha5 APN 6 140572950 missense probably damaging 0.99
IGL01408:Plekha5 APN 6 140570316 splice site probably benign
IGL01688:Plekha5 APN 6 140569389 missense probably damaging 0.98
IGL01719:Plekha5 APN 6 140570129 missense probably damaging 1.00
IGL01926:Plekha5 APN 6 140525916 missense probably benign 0.12
IGL01936:Plekha5 APN 6 140524895 missense probably damaging 1.00
IGL02326:Plekha5 APN 6 140583850 nonsense probably null
IGL02544:Plekha5 APN 6 140589728 missense possibly damaging 0.78
IGL02573:Plekha5 APN 6 140582016 missense probably damaging 1.00
IGL02704:Plekha5 APN 6 140543866 missense probably damaging 1.00
IGL02959:Plekha5 APN 6 140544178 missense probably damaging 1.00
Doubletime UTSW 6 140525929 nonsense probably null
R0067:Plekha5 UTSW 6 140524903 missense probably damaging 1.00
R0067:Plekha5 UTSW 6 140524903 missense probably damaging 1.00
R0095:Plekha5 UTSW 6 140528597 missense probably damaging 1.00
R0095:Plekha5 UTSW 6 140528597 missense probably damaging 1.00
R0105:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0107:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0359:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0360:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0362:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0363:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0364:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0365:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0833:Plekha5 UTSW 6 140589634 splice site probably benign
R0835:Plekha5 UTSW 6 140568850 nonsense probably null
R0836:Plekha5 UTSW 6 140589634 splice site probably benign
R0944:Plekha5 UTSW 6 140570196 splice site probably benign
R2015:Plekha5 UTSW 6 140534564 critical splice donor site probably null
R2043:Plekha5 UTSW 6 140552804 splice site probably benign
R2086:Plekha5 UTSW 6 140570318 splice site probably null
R2102:Plekha5 UTSW 6 140572877 missense probably damaging 1.00
R2109:Plekha5 UTSW 6 140424216 missense possibly damaging 0.56
R2135:Plekha5 UTSW 6 140580499 missense possibly damaging 0.66
R2150:Plekha5 UTSW 6 140570403 missense probably damaging 1.00
R2211:Plekha5 UTSW 6 140525861 missense possibly damaging 0.56
R2414:Plekha5 UTSW 6 140550856 missense probably damaging 1.00
R2915:Plekha5 UTSW 6 140589199 missense probably damaging 0.96
R3120:Plekha5 UTSW 6 140591641 missense probably benign 0.00
R3924:Plekha5 UTSW 6 140570379 missense possibly damaging 0.78
R4049:Plekha5 UTSW 6 140583871 missense probably damaging 1.00
R4056:Plekha5 UTSW 6 140589232 missense possibly damaging 0.46
R4077:Plekha5 UTSW 6 140555921 intron probably null
R4320:Plekha5 UTSW 6 140543817 missense possibly damaging 0.68
R4343:Plekha5 UTSW 6 140556054 missense probably damaging 0.99
R4359:Plekha5 UTSW 6 140591688 missense probably benign 0.07
R4377:Plekha5 UTSW 6 140579465 missense probably damaging 1.00
R4480:Plekha5 UTSW 6 140526479 missense probably damaging 1.00
R4533:Plekha5 UTSW 6 140570331 missense probably damaging 1.00
R4623:Plekha5 UTSW 6 140551186 missense probably damaging 0.98
R4672:Plekha5 UTSW 6 140524929 missense probably damaging 0.98
R4903:Plekha5 UTSW 6 140586367 missense probably damaging 1.00
R5121:Plekha5 UTSW 6 140579474 missense probably damaging 1.00
R5156:Plekha5 UTSW 6 140426528 missense probably damaging 1.00
R5376:Plekha5 UTSW 6 140551144 missense probably damaging 1.00
R5445:Plekha5 UTSW 6 140552733 nonsense probably null
R5753:Plekha5 UTSW 6 140537004 critical splice acceptor site probably null
R5836:Plekha5 UTSW 6 140426524 missense probably damaging 1.00
R5972:Plekha5 UTSW 6 140572913 missense possibly damaging 0.78
R6196:Plekha5 UTSW 6 140579453 missense probably benign 0.28
R6254:Plekha5 UTSW 6 140586436 missense probably damaging 1.00
R6501:Plekha5 UTSW 6 140525929 nonsense probably null
R6620:Plekha5 UTSW 6 140572875 missense probably damaging 1.00
R6663:Plekha5 UTSW 6 140577290 missense probably damaging 1.00
R6823:Plekha5 UTSW 6 140525858 missense probably benign 0.16
R6992:Plekha5 UTSW 6 140543908 missense probably damaging 1.00
R7196:Plekha5 UTSW 6 140543922 missense possibly damaging 0.83
R7487:Plekha5 UTSW 6 140570333 missense probably benign 0.25
R7493:Plekha5 UTSW 6 140580435 missense probably benign 0.02
R7557:Plekha5 UTSW 6 140426545 missense probably damaging 0.96
X0027:Plekha5 UTSW 6 140424423 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTCACTCATGTTAGGCTAGAATTAG -3'
(R):5'- GCTGATTCAACAGAATACCCATTC -3'

Sequencing Primer
(F):5'- GGCAACAGCATTAAAGTATTATTACC -3'
(R):5'- TCAACAGAATACCCATTCCCTCATAC -3'
Posted On2016-03-17