Incidental Mutation 'R4875:Mgat5'
ID376707
Institutional Source Beutler Lab
Gene Symbol Mgat5
Ensembl Gene ENSMUSG00000036155
Gene Namemannoside acetylglucosaminyltransferase 5
Synonyms4930471A21Rik, beta1,6N-acetylglucosaminyltransferase V, GlcNAc-TV, 5330407H02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4875 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location127205015-127488336 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 127469249 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 578 (V578M)
Ref Sequence ENSEMBL: ENSMUSP00000129166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038361] [ENSMUST00000171405]
Predicted Effect probably damaging
Transcript: ENSMUST00000038361
AA Change: V578M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038359
Gene: ENSMUSG00000036155
AA Change: V578M

DomainStartEndE-ValueType
Pfam:DUF4525 2 138 3.4e-70 PFAM
Pfam:Glyco_transf_18 171 725 9.8e-268 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171405
AA Change: V578M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129166
Gene: ENSMUSG00000036155
AA Change: V578M

DomainStartEndE-ValueType
Pfam:DUF4525 3 137 9.3e-64 PFAM
Pfam:Glyco_transf_18 171 725 1.9e-268 PFAM
Meta Mutation Damage Score 0.0732 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 95% (57/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the glycosyltransferase family. It catalyzes the addition of beta-1,6-N-acetylglucosamine to the alpha-linked mannose of biantennary N-linked oligosaccharides present on the newly synthesized glycoproteins. It is one of the most important enzymes involved in the regulation of the biosynthesis of glycoprotein oligosaccharides. Alterations of the oligosaccharides on cell surface glycoproteins cause significant changes in the adhesive or migratory behavior of a cell. Increase in the activity of this enzyme has been correlated with the progression of invasive malignancies. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for deficiencies in this gene have immune system abnormalities and reduced cancer growth and metastasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak1 A T 2: 32,631,177 E119D probably benign Het
Alox5 A T 6: 116,413,850 probably null Het
Atad5 T C 11: 80,120,689 V1294A probably damaging Het
BB019430 A G 10: 58,704,043 noncoding transcript Het
Bbs9 T C 9: 22,578,715 F261L probably benign Het
Catsperb A T 12: 101,587,985 N646I possibly damaging Het
Ccdc112 A G 18: 46,296,289 I114T probably damaging Het
Cecr2 T C 6: 120,750,916 L340P probably damaging Het
Ces2e T A 8: 104,927,185 V85E probably damaging Het
Cnpy2 C A 10: 128,326,095 T79K probably damaging Het
Cntn4 G A 6: 106,437,913 R135H possibly damaging Het
Cpne8 T A 15: 90,648,568 probably benign Het
Ctso C T 3: 81,942,381 probably benign Het
Cyp3a16 C A 5: 145,452,849 M235I probably benign Het
Dll3 A G 7: 28,296,435 C314R probably damaging Het
Dnah7c A G 1: 46,688,925 N2928D probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dqx1 C A 6: 83,061,012 D460E probably benign Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Ehbp1 A G 11: 22,101,164 C438R probably damaging Het
Ehd3 T G 17: 73,805,304 V21G probably damaging Het
Ero1lb G A 13: 12,604,436 V440I probably damaging Het
Fpgt G A 3: 155,087,913 A159V probably damaging Het
Gcn1l1 T C 5: 115,576,170 L123P possibly damaging Het
Gm14496 A T 2: 181,997,433 R439W probably damaging Het
Gm20767 T C 13: 120,154,670 V15A probably damaging Het
Gm4353 G C 7: 116,084,413 P49R probably damaging Het
Gsdmc2 C T 15: 63,828,252 A224T probably benign Het
Helz T A 11: 107,637,734 probably benign Het
Hnf1a T C 5: 114,970,673 T58A probably benign Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kcns1 T C 2: 164,168,101 Y246C probably damaging Het
Kif26b A G 1: 178,915,327 E549G probably benign Het
Krt9 T C 11: 100,190,037 I330V probably benign Het
Lair1 A T 7: 4,029,034 S25T probably benign Het
Lhx4 T C 1: 155,705,267 T171A possibly damaging Het
Luzp2 A G 7: 55,167,248 I149V possibly damaging Het
Mcoln1 T A 8: 3,507,422 S143T probably benign Het
Mcph1 A G 8: 18,625,558 probably null Het
Mis18bp1 G A 12: 65,161,435 T168M probably benign Het
Mospd4 G T 18: 46,465,737 noncoding transcript Het
Mroh2a G T 1: 88,254,935 R1195L possibly damaging Het
Myom1 T C 17: 71,072,119 V626A probably damaging Het
Nat6 C T 9: 107,583,619 R238C probably damaging Het
Ncam1 T C 9: 49,507,621 probably benign Het
Ncor1 AGCTGCTGCTGCTGCTGCTGCTGCTG AGCTGCTGCTGCTGCTGCTGCTG 11: 62,433,611 probably benign Het
Ndufv1 T C 19: 4,012,653 probably null Het
Nlrp2 A T 7: 5,298,859 F211L probably benign Het
Olfr1368 T A 13: 21,142,280 Y259F probably damaging Het
Olfr1495 T A 19: 13,768,762 M140K probably damaging Het
Olfr517 A T 7: 108,868,786 F123I probably damaging Het
Osbpl11 G A 16: 33,234,493 V649I probably benign Het
Pax8 T A 2: 24,441,640 M144L probably benign Het
Pcnt T C 10: 76,369,854 T2555A probably benign Het
Plat T A 8: 22,768,450 I23K probably benign Het
Plpp2 G A 10: 79,530,929 T51M probably damaging Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Prl7c1 T C 13: 27,773,759 M233V probably benign Het
Prox1 A C 1: 190,162,122 F42C probably damaging Het
Pwwp2b A T 7: 139,256,062 Q473L possibly damaging Het
Rims4 A T 2: 163,865,523 N127K probably null Het
Scn1a T C 2: 66,328,476 T367A possibly damaging Het
Slc23a2 A G 2: 132,056,880 I579T possibly damaging Het
Sp9 T C 2: 73,273,618 V172A possibly damaging Het
Spta1 T A 1: 174,175,830 L109Q probably damaging Het
Strap ACCTGCCCTCCT ACCT 6: 137,749,318 probably benign Het
Synj2 A T 17: 5,988,068 probably benign Het
Tgif2-ps2 A G 17: 40,115,383 noncoding transcript Het
Tnrc18 A T 5: 142,765,177 M1216K unknown Het
Tpst2 T A 5: 112,309,821 Y69* probably null Het
Tpx2 C A 2: 152,893,615 A721E probably benign Het
Trmt1l A G 1: 151,455,004 T591A probably benign Het
Tuba8 T A 6: 121,226,083 probably benign Het
Ubiad1 T C 4: 148,444,099 T118A possibly damaging Het
Unc13c T C 9: 73,517,284 T2017A probably damaging Het
Vmn1r59 G T 7: 5,454,109 N217K probably benign Het
Vmn2r87 T C 10: 130,472,498 I624V probably damaging Het
Wdr4 A G 17: 31,499,155 V315A probably benign Het
Xpo7 T C 14: 70,676,816 probably null Het
Zfp827 T A 8: 79,060,774 W190R probably damaging Het
Zfp971 A G 2: 178,033,147 T180A probably benign Het
Other mutations in Mgat5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Mgat5 APN 1 127387467 missense probably damaging 1.00
IGL00813:Mgat5 APN 1 127384806 missense probably benign
IGL01795:Mgat5 APN 1 127469231 missense probably damaging 0.98
IGL01830:Mgat5 APN 1 127412132 missense probably damaging 1.00
IGL01879:Mgat5 APN 1 127397550 missense probably damaging 0.99
IGL02322:Mgat5 APN 1 127382985 missense probably benign 0.00
IGL02621:Mgat5 APN 1 127397589 missense possibly damaging 0.86
IGL02695:Mgat5 APN 1 127412131 missense probably damaging 1.00
IGL03142:Mgat5 APN 1 127412223 missense probably damaging 1.00
R0518:Mgat5 UTSW 1 127384847 missense probably damaging 1.00
R0594:Mgat5 UTSW 1 127412248 missense probably damaging 0.96
R1480:Mgat5 UTSW 1 127459979 missense probably damaging 1.00
R1501:Mgat5 UTSW 1 127397641 critical splice donor site probably null
R1712:Mgat5 UTSW 1 127320638 missense probably benign 0.34
R1744:Mgat5 UTSW 1 127479469 missense probably damaging 1.00
R1862:Mgat5 UTSW 1 127459969 missense probably damaging 1.00
R1994:Mgat5 UTSW 1 127459959 missense possibly damaging 0.82
R2054:Mgat5 UTSW 1 127397607 missense probably damaging 1.00
R2150:Mgat5 UTSW 1 127469250 missense probably damaging 1.00
R2303:Mgat5 UTSW 1 127446299 missense probably benign 0.00
R2566:Mgat5 UTSW 1 127307004 missense probably benign 0.01
R3498:Mgat5 UTSW 1 127384834 missense possibly damaging 0.55
R3788:Mgat5 UTSW 1 127366443 missense probably benign
R4674:Mgat5 UTSW 1 127390758 missense probably damaging 1.00
R4873:Mgat5 UTSW 1 127469249 missense probably damaging 1.00
R5175:Mgat5 UTSW 1 127459912 missense probably damaging 0.97
R5310:Mgat5 UTSW 1 127387514 critical splice donor site probably null
R5337:Mgat5 UTSW 1 127459921 missense possibly damaging 0.84
R5597:Mgat5 UTSW 1 127397566 missense probably damaging 1.00
R5599:Mgat5 UTSW 1 127397566 missense probably damaging 1.00
R5861:Mgat5 UTSW 1 127387392 missense probably damaging 1.00
R5956:Mgat5 UTSW 1 127382939 missense probably benign 0.10
R6042:Mgat5 UTSW 1 127459899 missense probably damaging 1.00
R6223:Mgat5 UTSW 1 127382979 missense possibly damaging 0.86
R6492:Mgat5 UTSW 1 127471564 missense probably benign 0.36
R6662:Mgat5 UTSW 1 127469237 missense probably damaging 1.00
R6960:Mgat5 UTSW 1 127320634 missense possibly damaging 0.77
R6981:Mgat5 UTSW 1 127390851 missense probably damaging 0.98
X0028:Mgat5 UTSW 1 127366485 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TTGTTTGCTACAGGGAGGAC -3'
(R):5'- TTTACTGACAGCAAGGGACTG -3'

Sequencing Primer
(F):5'- GGAGGACAAGAACGCTTCATCTC -3'
(R):5'- GACTGCAATGTCCCACATGTG -3'
Posted On2016-03-17