Incidental Mutation 'R4875:Hnf1a'
ID376718
Institutional Source Beutler Lab
Gene Symbol Hnf1a
Ensembl Gene ENSMUSG00000029556
Gene NameHNF1 homeobox A
SynonymsHnf1alpha, HNF1-alpha, Tcf1, LFB1, hepatocyte nuclear factor 1, HNF1[a], HNF1, Hnf-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.491) question?
Stock #R4875 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location114948980-114971094 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 114970673 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 58 (T58A)
Ref Sequence ENSEMBL: ENSMUSP00000135539 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031535] [ENSMUST00000176550] [ENSMUST00000176911]
Predicted Effect probably benign
Transcript: ENSMUST00000031535
AA Change: T58A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000031535
Gene: ENSMUSG00000029556
AA Change: T58A

DomainStartEndE-ValueType
Pfam:HNF-1_N 8 168 4e-57 PFAM
HOX 199 282 1.85e-7 SMART
low complexity region 288 297 N/A INTRINSIC
Blast:HOX 394 439 7e-20 BLAST
Pfam:HNF-1A_C 540 627 3.4e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125010
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129609
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131845
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138108
Predicted Effect probably benign
Transcript: ENSMUST00000176550
AA Change: T58A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000135678
Gene: ENSMUSG00000029556
AA Change: T58A

DomainStartEndE-ValueType
Pfam:HNF-1_N 1 176 4e-86 PFAM
Blast:HOX 199 238 2e-20 BLAST
SCOP:d1lfb__ 203 238 2e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176911
AA Change: T58A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000135539
Gene: ENSMUSG00000029556
AA Change: T58A

DomainStartEndE-ValueType
Pfam:HNF-1_N 1 118 6.4e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184027
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202592
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 95% (57/60)
MGI Phenotype FUNCTION: This gene encodes a hepatic transcription factor. The encoded protein is not a member of the T-cell factor family, and is distinct from T-cell specific transcription factor 7 which has also been referred to by the symbol Tcf1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Most homozygous null mutants die at 3-6 weeks from progressive wasting syndrome, liver and renal dysfunction and type II diabetes. Mutants have little or no phenylalanine hydroxylase, albumin, alpha 1-antitrypsin and secreted insulin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak1 A T 2: 32,631,177 E119D probably benign Het
Alox5 A T 6: 116,413,850 probably null Het
Atad5 T C 11: 80,120,689 V1294A probably damaging Het
BB019430 A G 10: 58,704,043 noncoding transcript Het
Bbs9 T C 9: 22,578,715 F261L probably benign Het
Catsperb A T 12: 101,587,985 N646I possibly damaging Het
Ccdc112 A G 18: 46,296,289 I114T probably damaging Het
Cecr2 T C 6: 120,750,916 L340P probably damaging Het
Ces2e T A 8: 104,927,185 V85E probably damaging Het
Cnpy2 C A 10: 128,326,095 T79K probably damaging Het
Cntn4 G A 6: 106,437,913 R135H possibly damaging Het
Cpne8 T A 15: 90,648,568 probably benign Het
Ctso C T 3: 81,942,381 probably benign Het
Cyp3a16 C A 5: 145,452,849 M235I probably benign Het
Dll3 A G 7: 28,296,435 C314R probably damaging Het
Dnah7c A G 1: 46,688,925 N2928D probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dqx1 C A 6: 83,061,012 D460E probably benign Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Ehbp1 A G 11: 22,101,164 C438R probably damaging Het
Ehd3 T G 17: 73,805,304 V21G probably damaging Het
Ero1lb G A 13: 12,604,436 V440I probably damaging Het
Fpgt G A 3: 155,087,913 A159V probably damaging Het
Gcn1l1 T C 5: 115,576,170 L123P possibly damaging Het
Gm14496 A T 2: 181,997,433 R439W probably damaging Het
Gm20767 T C 13: 120,154,670 V15A probably damaging Het
Gm4353 G C 7: 116,084,413 P49R probably damaging Het
Gsdmc2 C T 15: 63,828,252 A224T probably benign Het
Helz T A 11: 107,637,734 probably benign Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kcns1 T C 2: 164,168,101 Y246C probably damaging Het
Kif26b A G 1: 178,915,327 E549G probably benign Het
Krt9 T C 11: 100,190,037 I330V probably benign Het
Lair1 A T 7: 4,029,034 S25T probably benign Het
Lhx4 T C 1: 155,705,267 T171A possibly damaging Het
Luzp2 A G 7: 55,167,248 I149V possibly damaging Het
Mcoln1 T A 8: 3,507,422 S143T probably benign Het
Mcph1 A G 8: 18,625,558 probably null Het
Mgat5 G A 1: 127,469,249 V578M probably damaging Het
Mis18bp1 G A 12: 65,161,435 T168M probably benign Het
Mospd4 G T 18: 46,465,737 noncoding transcript Het
Mroh2a G T 1: 88,254,935 R1195L possibly damaging Het
Myom1 T C 17: 71,072,119 V626A probably damaging Het
Nat6 C T 9: 107,583,619 R238C probably damaging Het
Ncam1 T C 9: 49,507,621 probably benign Het
Ncor1 AGCTGCTGCTGCTGCTGCTGCTGCTG AGCTGCTGCTGCTGCTGCTGCTG 11: 62,433,611 probably benign Het
Ndufv1 T C 19: 4,012,653 probably null Het
Nlrp2 A T 7: 5,298,859 F211L probably benign Het
Olfr1368 T A 13: 21,142,280 Y259F probably damaging Het
Olfr1495 T A 19: 13,768,762 M140K probably damaging Het
Olfr517 A T 7: 108,868,786 F123I probably damaging Het
Osbpl11 G A 16: 33,234,493 V649I probably benign Het
Pax8 T A 2: 24,441,640 M144L probably benign Het
Pcnt T C 10: 76,369,854 T2555A probably benign Het
Plat T A 8: 22,768,450 I23K probably benign Het
Plpp2 G A 10: 79,530,929 T51M probably damaging Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Prl7c1 T C 13: 27,773,759 M233V probably benign Het
Prox1 A C 1: 190,162,122 F42C probably damaging Het
Pwwp2b A T 7: 139,256,062 Q473L possibly damaging Het
Rims4 A T 2: 163,865,523 N127K probably null Het
Scn1a T C 2: 66,328,476 T367A possibly damaging Het
Slc23a2 A G 2: 132,056,880 I579T possibly damaging Het
Sp9 T C 2: 73,273,618 V172A possibly damaging Het
Spta1 T A 1: 174,175,830 L109Q probably damaging Het
Strap ACCTGCCCTCCT ACCT 6: 137,749,318 probably benign Het
Synj2 A T 17: 5,988,068 probably benign Het
Tgif2-ps2 A G 17: 40,115,383 noncoding transcript Het
Tnrc18 A T 5: 142,765,177 M1216K unknown Het
Tpst2 T A 5: 112,309,821 Y69* probably null Het
Tpx2 C A 2: 152,893,615 A721E probably benign Het
Trmt1l A G 1: 151,455,004 T591A probably benign Het
Tuba8 T A 6: 121,226,083 probably benign Het
Ubiad1 T C 4: 148,444,099 T118A possibly damaging Het
Unc13c T C 9: 73,517,284 T2017A probably damaging Het
Vmn1r59 G T 7: 5,454,109 N217K probably benign Het
Vmn2r87 T C 10: 130,472,498 I624V probably damaging Het
Wdr4 A G 17: 31,499,155 V315A probably benign Het
Xpo7 T C 14: 70,676,816 probably null Het
Zfp827 T A 8: 79,060,774 W190R probably damaging Het
Zfp971 A G 2: 178,033,147 T180A probably benign Het
Other mutations in Hnf1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01798:Hnf1a APN 5 114953673 missense probably damaging 1.00
IGL02192:Hnf1a APN 5 114960118 missense probably damaging 1.00
IGL03053:Hnf1a APN 5 114970733 missense probably benign 0.00
R0522:Hnf1a UTSW 5 114950688 splice site probably benign
R0543:Hnf1a UTSW 5 114950744 missense probably benign
R1498:Hnf1a UTSW 5 114970537 missense probably damaging 1.00
R1827:Hnf1a UTSW 5 114960195 missense probably damaging 1.00
R1852:Hnf1a UTSW 5 114970711 missense probably damaging 1.00
R2408:Hnf1a UTSW 5 114960011 splice site probably null
R2898:Hnf1a UTSW 5 114960047 nonsense probably null
R4050:Hnf1a UTSW 5 114970574 missense probably damaging 1.00
R4627:Hnf1a UTSW 5 114955871 missense probably damaging 1.00
R4859:Hnf1a UTSW 5 114955252 missense possibly damaging 0.84
R4873:Hnf1a UTSW 5 114970673 missense probably benign 0.00
R6488:Hnf1a UTSW 5 114955961 missense probably benign
X0067:Hnf1a UTSW 5 114955480 missense possibly damaging 0.52
Predicted Primers
Posted On2016-03-17